ONGene
Top
Scroll To Top
Gene information | Literature | Expression | lncRNA | Mutation | Homolog

Basic Information

Gene ID

3815

Name

KIT

Synonymous

v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog;KIT;v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog

Definition

mast/stem cell growth factor receptor Kit|p145 c-kit|piebald trait protein|proto-oncogene c-Kit|proto-oncogene tyrosine-protein kinase Kit|soluble KIT variant 1|tyrosine-protein kinase Kit|v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene-like protein

Position

4q12

Gene type

protein-coding

Title

Abstract

Spontaneous canine mast cell tumors express tandem duplications in the proto-oncogene c-kit.

Spontaneous mast cell tumors (MCT) are the most common malignant neoplasm in the dog, representing between 7% and 21% of ALL canine tumors, an incidence much higher than that found in humans. These tumors often behave in an aggressive manner, metastasizing to local lymph nodes, liver, spleen, and bone marrow. The proto-oncogene c-kit is known to play a critical role in the development and function of mast cells. Point mutations in the kinase domain of c-kit leading to tyrosine phosphorylation in the absence of ligand binding have been identified in three mastocytoma lines, (P815, RBL, and HMC-1), and some human patients with various forms of mastocytosis. We now demonstrate that although c-kit derived from canine MCT did not contain the previously described activating point mutations, 5 of the 11 tumors analyzed possessed novel mutations consisting of tandem duplications involving exons 11 and 12. We also show that one such duplication, detected in a canine mastocytoma cell line, was associated with constitutive phosphorylation of c-kit protein (KIT), suggesting that these mutations may contribute to the development or progression of canine MCT.

c-kit proto-oncogene exon 8 in-frame deletion plus insertion mutations in acute myeloid leukaemia.

Genomic DNA from 60 cases of acute myeloid leukaemia (AML) was screened for mutations in the c-kit gene. DNA from ALL 21 exons was subjected to polymerase chain reaction (PCR) amplification and analysis by conformation sensitive gel electrophoresis (CSGE); exons showing altered CSGE patterns were then sequenced. mutations were identified only in those patients with inv(16) (3/7 cases) or t(8;21) (1/2 cases) and comprised three in-frame deletion plus insertion mutations (exon 8) and one point mutation (exon 10, GTA --> ATA, Val530Ile). Exons 8 and 10 were then analysed in 31 further cases of inv(16) (n = 14) and t(8;21) (n = 17), revealing four additional exon 8 in-frame deletion plus insertion mutations, ALL of which were in cases of inv(16). ALL exon 8 in-frame deletion plus insertion mutations (n = 7) involved the loss or replacement of the codon for Asp419 which is highly conserved cross species and is located in the receptor s extracellular domain. The high frequency of the c-kit proto-oncogene exon 8 deletion plus insertion mutations in AML suggests an essential role for this region of the receptor s extracellular domain. The association with inv(16) invites speculation as to the link between these two changes in the pathogenesis of AML.

A single nucleotide polymorphism in the bovine kit oncogene (Hardy-Zuckerman 4 feline sarcoma viral (v-kit) oncogene homolog).

The c-myc gene and the expression of the c-Myc protein are frequently altered in human cancers. The c-myc gene encodes the transcription factor c-Myc, which heterodimerizes with a partner protein, termed Max, to regulate gene expression. Max also heterodimerizes with the Mad family of proteins to repress transcription, antagonize c-Myc, and promote cellular differentiation. The constitutive activation of c-myc expression is key to the genesis of many cancers, and hence the understanding of c-Myc function depends on our understanding of its target genes. In this review, we attempt to place the putative target genes of c-Myc in the context of c-Myc-mediated phenotypes. From this perspective, c-Myc emerges as an oncogenic transcription factor that integrates the cell cycle machinery with cell adhesion, cellular metabolism, and the apoptotic pathways.

Regulation of ferritin mRNA translation in primary erythroblasts: exogenous c-Kit plus EpoR signaling mimics v-ErbA oncoprotein activity.

In general, translation efficiency of ferritin mRNAs is modulated by variations in iron supply. In primary avian erythroblasts undergoing short-term proliferation, however, ferritin heavy chain (ferH) mRNA is repressed at ALL iron levels. Yet, expression of v-ErbA oncoprotein is sufficient to reinduce ferH mRNA utilization at physiological iron concentrations. Since overexpression of the receptor tyrosine kinase c-Kit and erythropoietin receptor (EpoR) stimulates long-term proliferation of primary erythroblasts like v-ErbA, we analyzed the impact of cooperation between c-Kit and EpoR on the regulation of iron storage. Whereas endogenous c-Kit in combination with exogenous EpoR had no significant effect, ectopic overexpression of both receptors abolished translational repression of ferH mRNA upon iron administration. Thus, high-intensity signaling through c-Kit plus EpoR pathways mimics the v-ErbA-mediated regulatory phenotype.

Specific mutation in exon 11 of c-kit proto-oncogene in a malignant gastrointestinal stromal tumor of the rectum.

Gastrointestinal stromal tumor (GIST) in the distal third of the rectum was detected in a 57-year-old man who underwent an abdominoperineal resection of the rectum. Because the tumor expressed CD34 and c-kit gene product, but did not express smooth muscle actin or S-100 protein, it was diagnosed as an uncommitted type of GIST. Moreover, a specific mutation in the sequence coding the juxtamembrane domain in exon 11 of the c-kit proto-oncogene was revealed by a polymerase chain reaction-single-strand conformation polymorphism method. One year after resection, the patient developed multiple liver metastases. It is suggested that a specific mutation in exon 11 of the c-kit proto-oncogene may have played an essential role in the development of the liver metastases.

Three novel mutations of the proto-oncogene KIT cause human piebaldism.

The oncogene GLI1 is involved in the formation of basal cell carcinoma and other tumor types as a result of the aberrant signaling of the Sonic hedgehog-Patched pathway. In this study, we have identified alternative GLI1 transcripts that differ in their 5 untranslated regions (UTRs) and are generated by exon skipping. These are denoted alpha-UTR, beta-UTR, and gamma-UTR according to the number of noncoding exons possessed (three, two, and one, respectively). The alpha- and beta-UTR forms represent the major Gli1 transcripts expressed in mouse tissues, whereas the gamma-UTR is present at relatively low levels but is markedly induced in mouse skin treated with 12-O-tetradecanoylphorbol 13-acetate. Transcripts corresponding to the murine beta and gamma forms were identified in human tissues, but significantly, only the gamma-UTR form was present in basal cell carcinomas and in proliferating cultures of a keratinocyte cell line. Flow cytometry analysis determined that the gamma-UTR variant expresses a heterologous reporter gene 14-23-fold higher than the alpha-UTR and 5-13-fold higher than the beta-UTR in a variety of cell types. Because expression of the gamma-UTR variant correlates with proliferation, consistent with a role for GLI1 in growth promotion, up-regulation of GLI1 expression through skipping of 5 noncoding exons may be an important tumorigenic mechanism.

Gastrointestinal stromal tumor with a novel mutation of KIT proto-oncogene.

The majority of human gastrointestinal mesenchymal tumors are gastrointestinal stromal tumors (GISTs). Recent reports have shown the existence of gain-of-function mutations in the juxta-membrane domain of receptor tyrosine kinase (KIT) in GISTs. We present a 77-year-old woman with GIST diagnosed by positive immunostaining of cluster designation (CD) 34 and KIT. This case had a novel mutation at codon 576 located in the juxta-membrane domain of KIT. Our results indicate the importance of mutations in this KIT region and suggest the possibility of the existence of other types of mutations in this region in GISTs.

Characterization of an undifferentiated malignancy as a mast cell tumor using mutation analysis in the proto-oncogene c-KIT.

A 6.5-year-old female Boxer was euthanized and presented for necropsy following rapid clinical decline concomitant with the development of numerous tumor masses. The largest of these masses was in the same location as a mast cell tumor that had been previously removed from this dog. Gross examination revealed the presence of nodules 5-200 mm in diameter throughout the body, including the lymph nodes. Histologic analysis showed an influx of round cells with no granules, leading to the provisional diagnosis of systemic lymphosarcoma. Immunohistochemical staining for B- and T-lymphocyte antigens was negative. Molecular tests were used to identify a tandem duplication in the c-KIT proto-oncogene from both the earlier mast cell tumor and the current nodules, implicating a common origin. Addition of molecular testing to conventional necropsy evaluations allowed a definitive diagnosis of mast cell tumors.

STI571 inactivation of the gastrointestinal stromal tumor c-KIT oncoprotein: biological and clinical implications.

mutations in the c-KIT receptor occur somatically in many sporadic Gastrointestinal Stromal tumors (GIST), and similar mutations have been identified at the germline level in kindreds with multiple GISTs. These mutations activate the tyrosine kinase activity of c-KIT and induce constitutive signaling. To investigate the function of activated c-KIT in GIST, we established a human GIST cell line, GIST882, which expresses an activating KIT mutation (K642E) in the first part of the cytoplasmic split tyrosine kinase domain. Notably, the K642E substitution is encoded by a homozygous exon 13 missense mutation, and, therefore, GIST882 cells do not express native KIT. GIST882 c-KIT protein is constitutively tyrosine phosphorylated, but tyrosine phosphorylation was rapidly and completely abolished after incubating the cells with the selective tyrosine kinase inhibitor STI571. Furthermore, GIST882 cells evidenced decreased proliferation and the onset of apoptotic cell death after prolonged incubation with STI571. Similar results were obtained after administering STI571 to a primary GIST cell culture that expressed a c-KIT exon 11 juxtamembrane mutation (K558NP). These cell-culture-based studies support an important role for c-KIT signaling in GIST and suggest therapeutic potential for STI571 in patients afflicted by this chemoresistant tumor.

The Genomic Structure of the Proto-Oncogene c-kit Encoded at the Murine White Spotting Locus.

The proto-oncogene c-kit encodes a transmembrane receptor with tyrosine kinase activity, which transduces signal from kit ligand (KL), and is responsible for hematogenesis, melanogenesis and gametogenesis during fetal development and adult life. Partial or complete loss of c-kit function due to mutation of the c-kit or KL gene accounts for the phenotypes of the murine White-spotting and Steel mutations, respectively. The c-kit protein has the structural features of extracellular immunoglobulin-like domains and intracellular kinase domain with a hydrophilic insert . These features have categorized c-kit along with platelet-derived growth factor receptors, colony-stimulating factor 1 receptor (c-fms) and others to subclass III of the receptor tyrosine kinases. We report the structure of the murine c-kit gene. The c-kit gene consists of 21 exons and spans at least 70 kb. The 5 and 3 flanking exons encode the untranslated sequences as well as part of the coding sequence. The internal exons are typically small with each of them encoding a structurally important subunit of the protein. Comparison of gene structures of members of the subclass III receptor tyrosine kinases has improved our understanding of the structure-functional relationship of the c-kit protein. Copyright 1995 S. Karger AG, BaselFAU - Chu, T.-Y.

Abnormality of c-kit oncoprotein in certain patients with chronic myelogenous leukemia--potential clinical significance.

Chronic myelogenous leukemia (CML) is characterized by the Philadelphia (Ph) chromosome and bcr/abl gene rearrangement which occurs in pluripotent hematopoietic progenitor cells expressing the c-kit receptor tyrosine kinase (KIT). To elucidate the biological properties of KIT in CML leukemogenesis, we performed analysis of alterations of the c-kit gene and functional analysis of altered KIT proteins. Gene alterations in the c-kit juxtamembrane domain of 80 CML cases were analyzed by reverse transcriptase and polymerase chain reaction-single strand conformation polymorphism (RT-PCR-SSCP). One case had an abnormality at codon 564 (AAT --> AAG, Asn --> Lys), and six cases had the same base abnormality at codon 541 (ATG --> CTG, Met --> Leu) in the juxtamembrane domain. Because the change from Met to Leu at codon 541 was a conservative one which was also observed in the normal population and normal tissues of CML patients, it probably represents a polymorphic variation. Although samples of hair roots and leukemic cells from the chronic phase of one CML patient showed no abnormality, an abnormality at codon 541 (ATG --> CTG, Met --> Leu) was found only at blastic crisis (BC) of this case. In the case with the abnormality at codon 564, the mutation was detected only in a sample of leukemic cells collected at BC. To examine the biological consequence and biological significance of these abnormalities, murine KIT(L540) and KIT(K563) expression vectors were introduced into interleukin-3 (IL-3)-dependent murine Ba/F3 cells to study their state of tyrosine phosphorylation and their growth rate. Ba/F3 cells expressing KIT(WT), KIT(L540) and KIT(K563) showed dose-dependent tyrosine phosphorylation after treatment with increasing concentrations of recombinant mouse stem cell factor (rmSCF). The cells expressing KIT(L540) and KIT(K563) were found to have greater tyrosine phosphorylation than cells expressing KIT(WT) at 0.1 and 1.0 ng/ml of rmSCF. The Ba/F3 cells expressing KIT(K563) proliferated in response to 0.1 and 1.0 ng/ml of rmSCF as well as IL-3. The Ba/F3 cells expressing KIT(L540)showed a relatively higher proliferative response to 0.1 ng/ml of rmSCF than the response of cells expressing KIT(WT). These mutations and in vitro functional analyses raise the possibility that the KIT abnormalities influence the white blood cell counts (P < 0.05) and survival (P < 0.04) of CML patients.

[Expression and clinical significance of c-kit oncogene in gastrointestinal stromal tumors].

OBJECTIVE: To investigate the clinicopathological and prognostic significance of the c-kit protein in gastrointestinal stromal tumor (GIST). METHODS: Paraffin embedded materials from 53 benign GISTs, 13 potentially malignant and 55 malignant cases were analysed for c-kit expression by immunohistochemical method, while using leiomyomas and schwannomas as controls. Positive signals were shown in cytoplasma and cell membrane. RESULTS: Of 122 GISTs, 118 (97%) were positive for c-kit. Localization of positive signals was accurate. The rate of c-kit protein in benign, potentially malignant and malignant cases was 98% (53/54), 93% (12/13), 96% (53/55) respectively. Compared with benign GIST, the positivity of c-kit in metastasis or recurrent cases decreased, but c-kit protein expression rate was not significantly different between the three patterns of GIST (chi(2) = 1.167, P > 0.05). Leiomyomas and schwannomas were typically c-kit negative. CONCLUSION: As a sensitive and specific marker of GIST, c-kit seems to be a useful antibody in the diagnosis and differential diagnosis of GIST, but it may not be used as a prognostic index.

Kaposi s sarcoma-associated herpesvirus-induced upregulation of the c-kit proto-oncogene, as identified by gene expression profiling, is essential for the transformation of endothelial cells.

Kaposi s sarcoma (KS), the most frequent malignancy afflicting AIDS patients, is characterized by spindle cell formation and vascularization. Infection with KS-associated herpesvirus (KSHV) is consistently observed in ALL forms of KS. Spindle cell formation can be replicated in vitro by infection of dermal microvascular endothelial cells (DMVEC) with KSHV. To study the molecular mechanism of this transformation, we compared RNA expression profiles of KSHV-infected and mock-infected DMVEC. Induction of several proto-oncogenes was observed, particularly the receptor tyrosine kinase c-kit. Consistent with increased c-Kit expression, KHSV-infected DMVEC displayed enhanced proliferation in response to the c-Kit ligand, stem cell factor (SCF). Inhibition of c-Kit activity with either a pharmacological inhibitor of c-Kit (STI 571) or a dominant-negative c-Kit protein reversed SCF-dependent proliferation. Importantly, inhibition of c-Kit signal transduction reversed the KSHV-induced morphological transformation of DMVEC. Furthermore, overexpression studies showed that c-Kit was sufficient to induce spindle cell formation. Together, these data demonstrate an essential role for c-Kit in KS tumorigenesis and reveal a target for pharmacological intervention.

Human piebaldism: six novel mutations of the proto-oncogene KIT.

Human piebaldism is a rare autosomal dominant disorder that comprises congenital patchy depigmentation of the scalp, forehead, trunk and limbs. It is caused by mutations in the cell-surface receptor tyrosine kinase gene (KIT, also c-kit). We screened three families and three isolated cases of piebaldism from different countries for mutations in the KIT gene using automated sequencing methods. We report six novel KIT point mutations: three missense (C788R, W835R, P869S) at highly conserved amino acid sites; one nonsense (Q347X) that results in termination of translation of the KIT gene in exon 6; and two splice site nucleotide substitutions (IVS13+2T>G, IVS17-1G>A) that are predicted to impair normal splicing. These mutations were not detected in over 100 normal individuals and are likely to be the cause of piebaldism in our subjects.

Necessity of tyrosine 719 and phosphatidylinositol 3 -kinase-mediated signal pathway in constitutive activation and oncogenic potential of c-kit receptor tyrosine kinase with the Asp814Val mutation.

Substitution of valine (Val) for aspartic acid (Asp) at codon 814 constitutively activates murine c-kit receptor tyrosine kinase (KIT), and Asp816Val mutation, corresponding to murine Asp814Val mutation, is found in patients with mastocytosis and acute myelocytic leukemia. However, the signal transduction pathways responsible for oncogenesis by the Asp814Val mutant (KIT(Val814)) are not fully understood. To examine the oncogenic signal transduction of KIT(Val814), we converted 20 tyrosine (Tyr) residues to phenylalanine (Phe) in the cytoplasmic domain of KIT(Val814) or deleted the C-terminal region containing 2 other tyrosine residues (Del). Among various KIT(Val814)- derived mutants, KIT(Val814-Tyr719Phe) and KIT(Val814-Del) severely impaired receptor tyrosine phosphorylation and association with the p85 subunit of phosphatidylinositol 3 -kinase (p85 (PI3-K)). Moreover, KIT(Val814-Tyr719Phe) and KIT(Val814-Del) failed to induce ligand-independent growth in Ba/F3 cells, indicating that Tyr719, the binding site for p85(PI3-K), and the C-terminal region are indispensable for factor-independent growth by KIT(Val814). Although the C-terminal region was also required for ligand-dependent growth by wild-type KIT (KIT(WT)), the Tyr719Phe substitution had negligible effects on ligand-dependent growth by KIT(WT). Furthermore, dominant-negative PI3-K significantly inhibited ligand-independent growth by KIT(Val814). These results demonstrate that Tyr719 is crucial for constitutive activation of KIT(Val814), but not for the ligand-induced activation of KIT(WT), and that the downstream signaling of PI3-K plays an important role in ligand-independent growth and tumorigenicity by KIT(Val814), thereby suggesting that KIT(Val814) is a unique activating mutation that leads to a distinguishable function from the effects of KIT(WT).

Functional and phenotypic studies of two variants of a human mast cell line with a distinct set of mutations in the c-kit proto-oncogene.

The human mast cell line (HMC)-1 cell line is growth-factor independent because of a constitutive activity of the receptor tyrosine kinase Kit. Such deregulated Kit activity has also been suggested causative in gastrointestinal stromal tumours (GISTs) and mastocytosis. HMC-1 is the only established continuously growing human mast cell line and has therefore been widely employed for in vitro studies of human mast cell biology. In this paper we describe two sublines of HMC-1, named HMC-1(560 ) and HMC-1(560,816 ), with different phenotypes and designated by the locations of specific mutations in the c-kit proto-oncogene. Activating mutations in the Kit receptor were characterized using the pyrosequencing trade mark method. Both sublines have a heterozygous T to G mutation at codon 560 in the juxtamembrane region of the c-kit gene causing an amino acid substitution of Gly-560 for Val. In contrast, only HMC-1(560,816) cells have the c-kitV816 mutation found in mast cell neoplasms causing an Asp-->Val substitution in the intracellular kinase domain. Kit was constitutively phosphorylated on tyrosine residues and associated with phosphatidylinositol 3 -kinase (PI 3-kinase) in both variants of HMC-1, but this did not lead to a constitutive phosphorylation of Akt or extracellular regulated protein kinase (ERK), which are signalling molecules normally activated by the interaction of stem cell factor (SCF) with Kit. The documentation and characterization of two sublines of HMC-1 cells provides both information on the biological consequences of mutations in Kit and recognition of the availability of what in reality are two distinct cultured human mast cell lines.

Organization and nucleotide sequence of the human KIT (mast/stem cell growth factor receptor) proto-oncogene.

We have cloned and sequenced the human KIT proto-oncogene, which contains 21 exons and spans more than 34 kb of DNA on chromosome segment 4q12. We also establish physical linkage between the KIT gene and the related PDGFRA gene. The organization of the KIT gene is virtually identical to that of the homologous FMS gene, located on chromosome 5. Together, these data suggest that the KIT and PDGFRA genes on chromosome 4 and the FMS and PDGFRB genes on chromosome 5 arose by duplication of a common ancestral gene, followed by duplication of a chromosome.

Expression of c-kit, a proto-oncogene of the murine W locus, in cerebella of normal and neurological mutant mice: immunohistochemical and in situ hybridization analysis.

The c-kit proto-oncogene encodes a receptor tyrosine kinase and is allelic with the murine white-spoting (W) locus. Although no apparent defects in the brain have been reported in W mutant mice, brain tissue, especially cerebellum, shows a high level of c-kit transcription. In the present study, sites of c-kit expression in the cerebellum were exained by immunohistochemical and in situ hybridization techniques. Immunohistochemistry with a monoclonal antibody against c-Kit protein revealed that the c-Kit protein was localized close to the Purkinje cell soma in the region facing the granular cell layer. Similar distribution of the c-Kit protein was observed in cerebella of mutant mice in which the Purkinje cell (pcd) or the granular cell layer (weaver) is missing. These data suggest that the c-Kit protein is produced not by the Purkinje cell nor by the granular cell but by the cells present in the molecular layer and that the protein is then transported to the region around the Purkinje cell soma. This interpretation was supported by in situ hybridization analysis: cells containing the c-kit transcripts were found only in the molecular layer, while the granular and Purkinje cells were negative.

The proto-oncogene c-kit is expressed in leiomyosarcomas of the uterus.

OBJECTIVE: The proto-oncogene c-kit encodes for a 145-kDa transmembrane tyrosine kinase receptor. Interaction with its ligand, stem cell factor, is essential in the development of hematopoietic stem cells, mast cells, gametocytes, melanocytes, and interstitial cells of Cajal. C-kit expression has been identified in a number of different neoplasms that includes mastocytosis/mast cell leukemia, acute myeloblastic leukemia, seminoma/dysgerminoma, and gastrointestinal stromal tumors. This study examines c-kit expression in uterine endometrial stromal sarcomas, leiomyomas, and leiomyosarcomas using immunohistochemistry. METHODS: Archival tissue from 38 patients with the uterine mesenchymal tumors (16 leiomyosarcomas, 8 leiomyomas, 11 low-grade endometrial stromal sarcomas, and 3 high-grade endometrial stromal sarcomas) was stained with polyclonal antibody for c-kit. Modified avidin biotin (ABC) immunoperoxidase method was employed for antibody detection. Individual tumors were considered positive if more than 10% of the cells comprising the neoplasm displayed immunoreactive staining. Staining intensity was graded 1+ to 3+ and distribution graded as focal (10-30% of the cells), intermediate (30-60% of the cells), or diffuse (>60% of the cells). RESULTS: C-kit was positive in 12 (75%) of the 16 leiomyosarcomas. The staining was 3+ and diffuse in the majority of the positive tumors. C-kit expression was not detected in any of the 8 leiomyomas. Two of the 3 high-grade endometrial stromal sarcomas displayed c-kit positivity. Staining was diffuse and 3+ in both of these tumors. expression of c-kit was observed in only 3 of the 11 low-grade endometrial stromal sarcomas. CONCLUSIONS: C-kit is expressed in uterine leiomyosarcomas and endometrial stromal sarcomas. Adjunctive diagnostic studies using c-kit may be useful in distinguishing leiomyosarcomas from benign leiomyomas in uterine tumors that offer uncharacteristic features. Furthermore, studies should investigate the prospect of treating these malignant tumors with tyrosine kinase inhibitors.

Deletion of Trp-557 and Lys-558 in the juxtamembrane domain of the c-kit protooncogene is associated with metastatic behavior of gastrointestinal stromal tumors.

Gastrointestinal stromal tumors (GISTs) typically express high levels of the Kit-receptor. The majority of GISTs carry mutations in the c-kit protooncogene clustering in exon 11. The significance of c-kit mutations for the biological behavior of GISTs is still under discussion. We evaluated 55 sporadic GISTs with available follow-up data for c-kit mutations in the juxtamembrane domain and detected mutations in 35 cases (63.6%). We found a mutational hotspot in codons 557 (tryptophan) and 558 (lysine) preferentially in histomorphologically malignant tumors. In the group of GISTs carrying c-kit mutations, 16 of 21 malignant, but only 3 of 8 benign GISTs and 3 of 6 lesions with uncertain malignant potential, carried mutations of Trp-557 and/or Lys-558. We investigated whether mutations in these 2 amino acids had an impact on biological behavior. Trp-557 and/or Lys-558 were mutated in ALL 15 metastatic GISTs carrying c-kit mutations but only in a minority of nonmetastatic tumors. A combined deletion of Trp-557 and Lys-558 occurred exclusively in 8 metastatic GISTs. We conclude that in addition to histomorphological evaluation determination of mutations in exon 11 may be an additional parameter for predicting the metastatic risk of GISTs and may be important for the decision that patients will need close clinical follow-up or further adjuvant treatment with kit antagonists.

Expression of proto-oncogene c-kit receptor in rats (Rattus norvegicus) and identification of a mutant mRNA transcript implicated in spermatogenic failure.

The pleiotropic proto-oncogene c-kit receptor, implicated in hematopoiesis and melanogenesis, is also known to play an important role in germ cell proliferation and differentiation although the mechanisms for the latter remain unknown. We studied c-kit expression by RT-PCR in various tissues of both fertile and infertile Brown Norway rats. Using different sets of primers, several regions from within the extracellular domain were amplified, cloned, and sequenced. One set of primers, in addition to the expected 352-bp amplicon, revealed a 276-bp transcript, although its biological functions remain unknown. These two transcripts showed varying levels of expression in different tissues of infertile rats against nearly uniform expression in the fertile animals. Significantly, the 352 bp testis transcript showed mutational hotspots from nucleotide 84-266 in the infertile rats. Analysis of testis and brain genomic DNA from these infertile rats showed mutations only in the testis suggesting this to be a postzygotic event. In contrast, no mutation was detected in the genomic DNA of testis and brain of the fertile rats. Protein expression studies showed complete absence of the cytoplasmic kinase domain and soluble c-kit protein in one of the infertile rats. Histological examination of testis of these infertile animals showed stem cell depletion resulting in fewer germ cells. Based on these results, we infer that 352-bp mutant mRNA transcript is implicated in the spermatogenic failure.

Dominant negative and loss of function mutations of the c-kit (mast/stem cell growth factor receptor) proto-oncogene in human piebaldism.

Piebaldism is an autosomal dominant disorder of melanocyte development and is characterized by congenital white patches of skin and hair from which melanocytes are completely absent. A similar disorder of the mouse, "dominant white spotting" (W), results from mutations of the c-kit proto-oncogene, which encodes the cellular tyrosine kinase receptor for the mast/stem cell growth factor. We have identified c-kit gene mutations in three patients with piebaldism. A missense substitution (Phe----Leu) at codon 584, within the tyrosine kinase domain, is associated with a severe piebald phenotype, whereas two different frameshifts, within codons 561 and 642, are both associated with a variable and relatively mild piebald phenotype. This is consistent with a possible "dominant negative" effect of missense c-kit polypeptides on the function of the dimeric receptor.

Analysis of the close relationship between human astrocytoma-specific antigens detected by murine monoclonal antibodies and c-kit proto-oncogene product.

Tyrosine-specific phosphorylated proteins found exclusively on the cell surface of human astrocytomas were previously identified with murine monoclonal antibodies, designated as GA-17, GB-4 and GC-3. The purpose of this study was to further characterize the antigens and investigate the relationship between them and c-kit protooncogene product. We demonstrated that the antigens had protein kinase activity. Moreover, GA-17 reacted with c-kit protein expressed on the membrane of A172 human glioblastoma cells.

Structural organization of the murine c-kit proto-oncogene.

The murine Kit receptor gene on chromosome 5 has been found to be frequently involved in germline mutations and rearrangements, leading to a characteristic set of severe developmental defects, known as the W phenotype. Here we describe the structure of the murine c-kit gene, based on restriction analysis of genomic phage clones and sequence determination of exon-intron boundaries. The Kit-coding region is distributed over 21 exons, most of which have sizes that range between 100 and 200 base pairs. The 3 non-translated sequence and the 3 end of the coding region form a single large exon, which encompasses 2.3 kb and is flanked by polyadenylation signals. The entire region spans a genomic distance of at least 70 kb. Though the exonic demarcations of c-kit show remarkable similarity to those of the human c-fms gene (which encodes the highly related colony-stimulating factor 1 receptor), no correlation could be found between the sizes of introns that separate homologous exon pairs. The data suggest that evolutionary pressures were confined to the conservation of structures of coding exons, whereas flanking regions were subject to large changes, owing to insertions and deletions. Finally, the analysis of the Kit genomic structure reveals that the inherited mutations of the Kit gene that have been reported thus far occur at various dispersed positions within the gene. Hence, the entire gene appears to have as yet unknown features which cause it to be frequently subject to mutations in murine germline tissues.

The c-kit proto-oncogene in normal and malignant human hematopoiesis.

The c-kit proto-oncogene encodes a tyrosine kinase receptor (KIT) which is expressed on many types of human cells. Numerous studies attest to the importance of the c-kit receptor and its ligand, known variously as stem cell factor (SCF), mast cell growth factor (MGF), Steel factor (SF), or kit ligand (KL) (the nomenclature we prefer), in the development of human hematopoietic cells. KL, which is produced in membrane-bound and soluble forms by bone marrow stromal cells, acts on pre-colony forming units (pre-CFU) and CFU cells. In synergistic combination with other cytokines, KL enhances the growth of myeloid progenitor cells. However, using an antisense oligodeoxynucleotide strategy to disrupt c-kit function, we have demonstrated that the KL-KIT complex is of greatest importance for generation and/or proliferation of normal human erythropoietic progenitor cells. In malignant hematopoietic cells, the complex also appears to be important for growth of granulocyte/macrophage (GM) CFU as well.

Steel factor stimulates the tyrosine phosphorylation of the proto-oncogene product, p95vav, in human hemopoietic cells.

Steel factor (SF) (also called stem cell factor, mast cell growth factor, or c-kit ligand) is a recently cloned hemopoietic growth factor that is produced by bone marrow stromal cells, fibroblasts, and hepatocytes. In both mouse and man it acts synergistically with several colony stimulating factors, including interleukin-3 (IL-3) and granulocyte macrophage-colony stimulating factor (GM-CSF), to induce the proliferation and differentiation of primitive hemopoietic precursor cells. In order to study its mechanism of action and to explore the molecular basis for its synergistic activity we have examined the proteins that become tyrosine phosphorylated in response to SF, IL-3, and GM-CSF. We report herein that SF, but not IL-3 or GM-CSF, dramatically stimulates the tyrosine phosphorylation of the product of the recently discovered proto-oncogene, vav, in two SF-responsive human cell lines, M07E and TF-1. Although phosphorylation is very rapid, reaching maximal levels within 2 min at 37 degrees C, co-immunoprecipitation studies suggest that c-kit may either not associate directly with p95vav or bind to it with very low affinity. Nonetheless, our data suggest that c-kit may utilize p95vav to mediate downstream signaling in hemopoietic cells.

Progression of human cutaneous melanoma is associated with loss of expression of c-kit proto-oncogene receptor.

mutations at the white spotting (w) locus in mice have deleterious effects on germ cells, melanocytes and hematopoietic stem cells. The w locus encodes the c-kit tyrosine-kinase receptor whose ligand is the product of the SI locus. Using monoclonal antibodies (MAb(s)) to the extracellular domain, we have evaluated the expression of c-kit in normal and transformed melanocytes. This cell lineage synthesizes a receptor with a mw of 145 kDa. The gene product is expressed in epidermal melanocytes and in a fraction of nevocytic and blue nevi. In primary melanomas, loss of the receptor is observed in more invasive lesions. Only 30% of the metastatic lesions express detectable levels of the receptor. These findings demonstrate that the c-kit product is down-regulated in melanocytes following malignant transformation. The functional relevance of this modulation remains to be evaluated.

Lack of c-kit proto-oncogene rearrangement in patients with acute lymphoblastic leukemia (ALL) and the t(4;11)(q21;q23) translocation.

The oncogene HER-2/neu encodes a transmembrane glycoprotein of 185 kDa (gp185HER-2) with tyrosine-kinase activity. Gene amplification and high levels of expression of gp185HER-2 have been found to correlate with poor clinical outcome in breast and ovarian carcinomas. Employing a somatic cell hybrid fusion protocol, which yields a high frequency production of hybridomas, we have analyzed the extent of the murine immune response to the gp 185 extracellular domain. In a single fusion experiment, using as immunogen NIH 3T3 cells expressing high levels of a transfected human HER-2 gene, we have generated mAbs, mainly of IgG1 isotype, displaying high affinity (10(7)-10(10) mol/L) to gp 185. Analysis of the epitope specificity has allowed the identification of five distinct groups of spatially related epitopes, each provided with different immunodominancy, and ALL resistant to formalin fixation. The use of inhibitor of N-linked glycosylation tunicamicyn has demonstrated that the mAbs bind to epitopes localized in the protein core of gp185HER-2. Because recent reports have shown that gp185HER-2 has a restricted expression in normal tissues and is homogenously detectable in metastatic foci of gp 185 + primary tumors, antibodies to this macromolecule, in addition to their prognostic value, may represent reagents for in vitro and in vivo diagnostic applications, as well as for the development of therapeutic strategies.

Mutations of the KIT (mast/stem cell growth factor receptor) proto-oncogene account for a continuous range of phenotypes in human piebaldism.

Piebaldism is a rare autosomal dominant disorder of pigmentation, characterized by congenital patches of white skin and hair from which melanocytes are absent. We have previously shown that piebaldism can result from missense and frameshift mutations of the KIT proto-oncogene, which encodes the cellular receptor tyrosine kinase for the mast/stem cell growth factor. Here, we report two novel KIT mutations associated with human piebaldism. A proximal frameshift is associated with a mild piebald phenotype, and a splice-junction mutation is associated with a highly variable piebald phenotype. We discuss the apparent relationship between the predicted impact of specific KIT mutations on total KIT-dependent signal transduction and the severity of the resultant piebald phenotypes.

Breast cancer is associated with loss of the c-kit oncogene product.

The proto-oncogene c-kit encodes a tyrosine kinase receptor related to the PDGF/CSF-1 receptors. mutations of this gene result in impairment of hematopoiesis, melanogenesis and gametogenesis. Using monoclonal antibodies to the c-kit gene product, we have analyzed its expression in normal and transformed human tissues. Unexpectedly, the receptor was found to be expressed in normal mammary epithelium. While in benign breast lesions, the c-kit gene product was detected at variable levels in 82% of the instances, in primary tumors, no product could be identified in 87% of the cases. This phenotype is maintained in metastatic foci. These findings were confirmed by paired Northern blot analysis of RNA preparations from normal and tumor tissues. These results demonstrate that the c-kit receptor may also be involved in the growth control of mammary epithelium and that this function may be impaired following malignant transformation and de-differentiation.

c-kit proto-oncogene product is rarely detected in colorectal adenocarcinoma.

The multiplicity of transcription factors involved in hematologic malignancies suggests a complicated scenario in which many different molecular mechanisms lead to malignant transformation. We hypothesized that some of these proteins might physically and functionally interact and thus mechanistically link different diseases. The ETO protein of t(8;21) acute myeloid leukemia (AML) is an excellent candidate as a common factor because it is normally expressed in human hematopoietic cells, it binds to histone deacetylases (HDACs), and it interacts with the PLZF protein of t(11;17) acute promyelocytic leukemia. To determine whether ETO functionally links a broader range of disease entities, we asked whether ETO forms a complex with the Bcl-6 oncoprotein of B-cell lymphomas. We found that ETO and Bcl-6 are coexpressed in normal and malignant lymphoid tissue, where they interact and colocalize in nuclear speckles. ETO binds to the fourth zinc finger of Bcl-6, enhances Bcl-6 repression of artificial and endogenous genes in an HDAC-dependent manner, and forms a complex with Bcl-6 on the promoters of its endogenous target genes in B-cell lymphoma cells. Therefore, ETO is a bona fide corepressor that links the transcriptional pathogenesis of acute leukemias and B-cell lymphomas and offers a compelling target for transcriptional therapy of hematologic malignancies.

The meaning of the c-kit proto-oncogene product in malignant transformation in human mammary epithelium.

To evaluate the relationship between the c-kit proto-oncogene product and malignant transformation of human breast tissue, we examined the immunohistochemical expression of the c-kit proto-oncogene product in both malignant and non-malignant breast tissues. The immunohistochemical expression of the c-kit proto-oncogene product in 40 primary breast cancer tissues (22 axillary lymph nodes negative, 18 lymph nodes positive), in 18 corresponding axillary lymph nodes, and in 10 distant metastastic tissues were studied using an anti-c-kit proto-oncogene product antibody in comparison with 20 normal and 20 benign breast tissues. The mean values of immunoreactive score (IRS) were compared. The IRS of the c-kit proto-oncogene product in normal mammary epithelia was 5.90 +/- 1.37 (mean +/- s.d.). In benign tissues, the c-kit proto-oncogene product was detected heterogeneously with a reduced IRS (4.05 +/- 1.82). In primary breast cancer tissues, the expression of the c-kit proto-oncogene product was often deleted and the average IRS (0.90 +/- 1.73) was significantly reduced compared to those of the normal breast tissues or benign breast disease tissues, but no significant difference was shown between the breast cancer groups. The c-kit proto-oncogene product may correlate with growth control or the differentiation of normal breast epithelium. This result suggests that the loss of expression of this protein might correlate with malignant breast cancer progression, but it is most likely involved at an early stage of human breast cancer development.

Immunohistochemical evaluation of the c-kit proto-oncogene in sarcomas of the uterus: a case series.

OBJECTIVE: To evaluate the incidence of c-kit expression in uterine sarcomas. STUDY DESIGN: Immunohistochemical evaluation for expression of c-kit was performed on specimens from 11 patients with pathologically documented uterine sarcomas. Histologic subtypes included 5 carcinosarcomas, 3 leiomyosarcomas and 3 endometrial stromal sarcomas. Histologic sections of formalin-fixed, paraffin-embedded hysterectomy specimens from patients with uterine sarcomas were immunostained with c-kit (CD117) antibody. Overall staining intensity was graded as strong, intermediate or weak. RESULTS: In ALL 11 patients with uterine sarcoma, c-kit immunostaining was positive. Four specimens demonstrated stronger staining intensity than did the gastrointestinal stromal tumor control. Five specimens demonstrated intermediate staining intensity. Two specimens demonstrated weak staining intensity. Furthermore, in the carcinosarcoma specimens both the epithelial and sarcomatous elements were positive for c-kit staining. CONCLUSION: In this case series, c-kit expression was demonstrated in ALL sarcomas of the uterus regardless of histologic type. These results suggest that such drugs as imatinib mesylate, which inhibit the c-kit tyrosine kinase, should be investigated for these mesenchymal neoplasms.

Expression of the proto-oncogene c-KIT in normal and tumor tissues from colorectal carcinoma patients.

BACKGROUND AND AIMS: The proto-oncogene c-KIT encodes a tyrosine kinase receptor essential during embryonic development and postnatal life. Although deregulated expression of c-KIT has been reported, its role in colorectal carcinoma remains controversial: some authors have described a correlation between c-KIT expression and colorectal cancer (CRC), while others have failed to detect the receptor in the majority of neoplasia examined. To address this question, we designed a prospective study to analyze the expression of c-KIT in normal and neoplastic colonic mucosa of the same patient. PATIENTS AND METHODS: We analyzed the tissues of 20 patients undergoing surgical resection for colorectal carcinoma by reverse transcriptase-polymerase chain reaction, Western blot and immunohistochemistry, whose results were correlated with histopathological parameters. RESULTS: Most patients (90%) showed c-KIT expression in normal tissue both at RNA and protein level, while in neoplastic tissue it was observed in 30% of patients at RNA level and in 10% at protein level. By immunohistochemistry the localization of c-KIT protein in the normal colon was restricted to interstitial cells scattered in the stroma, whereas the non-neoplastic epithelium was always negative. The mucinous carcinomas were ALL c-KIT negative, whereas the only case in which c-KIT was displayed in the neoplastic epithelium was a G3 adenocarcinoma. CONCLUSION: Most colorectal carcinomas do not express c-KIT. We suggest that c-KIT expression is rarely present in this neoplasia; thus, the use of receptor inhibitors should be conducted in selected sub-groups of colon carcinoma patients, subsequent to the clear demonstration of c-KIT overexpression in the neoplastic cells.

Expression of c-kit proto-oncogene product in breast tissue.

The proto-oncogene c-kit encodes a transmembrane tyrosine kinase growth factor receptor. Stem cell factor, the receptor ligand, plays an important role in the development of certain neoplasms. c-kit is selectively and competitively bound by STI-571, a newly developed tyrosine kinase inhibitor. Several investigators report conflicting results concerning its expression, especially in malignant breast lesions. The objective of this study was to better characterize the expression of c-kit within the spectrum of breast epithelium (normal breast epithelium, nonneoplastic lesions, and breast carcinoma). Seventy-seven randomly selected breast tissue samples, each containing normal breast epithelium (21), invasive breast carcinoma (41), in situ breast carcinoma (29), papilloma (8), fibroadenoma (5), fibrocystic change (11), and/or metastatic breast carcinoma (4), were immunostained with polyclonal rabbit antihuman c-kit (Dako, Carpenteria, CA) at a dilution of 1:200. The staining was interpreted as negative if no cells were immunoreactive, weak positive if 5% of the cells were immunoreactive, and positive if more than 5% of the cells were immunoreactive. Appropriate positive and negative controls were used. The observed staining was cytoplasmic, with highlighting of the nuclear membrane. Normal breast epithelium was positive in ALL cases. More than half of the cases of hyperplastic changes and benign neoplasms (fibroadenoma and papilloma) were positive. Only 10% of invasive and in situ carcinomas showed positivity for c-kit. c-kit is consistently expressed in normal breast epithelium, variably expressed in benign breast lesions, and poorly expressed in breast carcinoma. These data suggest that c-kit may play a role in breast tumor progression and may therefore have diagnostic, prognostic, and therapeutic implications.

Sensitivity of oncogenic KIT mutants to the kinase inhibitors MLN518 and PD180970.

Oncogenic mutations of the receptor tyrosine kinase KIT occur in gastrointestinal stromal tumors (GISTs), some cases of acute myelogenous leukemia (AML), and systemic mastocytosis (SM). GISTs commonly contain mutations of the KIT juxtamembrane region while SM and AML harbor active site KIT mutations. Imatinib, which potently inhibits juxtamembrane mutants, is effective for the treatment of GISTs but has no activity against active site mutants. We analyzed the inhibitory potential of 2 small molecule inhibitors, MLN518 and PD180970, against different classes of KIT mutants. Both compounds inhibit the growth of cell lines expressing juxtamembrane mutant KIT. MLN518 additionally targets active site mutant cell lines, inhibiting cell proliferation, KIT, and signal transducer and activator of transcription-3 (Stat3) phosphorylation and inducing apoptosis at concentrations that may be clinically achievable. As phase 1 clinical trials of MLN518 in AML have shown little toxicity, our data suggest MLN518 is a promising candidate for the treatment of SM or AML with KIT mutations.

Expression of proto-oncogene c-kit in high risk prostate cancer.

AIMS: We determined whether c-kit proto-oncogene is expressed in prostate cancer and whether its expression is related with biochemical relapse in high risk localized prostate cancer patients. METHODS: c-Kit expression was evaluated by immuno-histochemistry in 94 prostate cancer samples from patients treated by radical prostatectomy followed by adjuvant hormonal therapy because ALL patients had a pT3a stage (initially cT2 stage). ALL patients presented a >7 Gleason score and a >10 pre-operative PSA value. We evaluated association between c-kit positive staining and disease free survival. RESULTS: In 26 of 94 prostate cancer, we found an epithelial positive c-kit expression. The epithelial expression was found in the peripheral zone of prostate tissue. 13/94 relapsed and, although not statistically significant (p 0.055), a trend to a higher risk of relapse among the c-kit positive samples was observed in our series of prostate cancer patients. CONCLUSIONS: Our study is only an initial experience and it is necessary to consider a higher number of patients to clarify whether c-kit is really an independent predictor for disease recurrence. Further study in this area will help to understand whether anti c-kit drugs could become an effective complement to the armamentarium of prostate cancer therapies.

PKCdelta plays opposite roles in growth mediated by wild-type Kit and an oncogenic Kit mutant.

The Kit receptor tyrosine kinase is critical for normal hematopoiesis. mutation of the aspartic acid residue encoded by codon 816 of human c-kit or codon 814 of the murine gene results in an oncogenic form of Kit. Here we investigate the role of protein kinase Cdelta (PKCdelta) in responses mediated by wild-type murine Kit and the D814Y mutant in a murine mast cell-like line. PKCdelta is activated after wild-type (WT) Kit binds stem cell factor (SCF), is constitutively active in cells expressing the Kit catalytic domain mutant, and coprecipitates with both forms of Kit. Inhibition of PKCdelta had opposite effects on growth mediated by wild-type and mutant Kit. Both rottlerin and a dominant-negative PKCdelta construct inhibited the growth of cells expressing mutant Kit, while SCF-induced growth of cells expressing wild-type Kit was not inhibited. Further, overexpression of PKCdelta inhibited growth of cells expressing wild-type Kit and enhanced growth of cells expressing the Kit mutant. These data demonstrate that PKCdelta contributes to factor-independent growth of cells expressing the D814Y mutant, but negatively regulates SCF-induced growth of cells expressing wild-type Kit. This is the first demonstration that PKCdelta has different functions in cells expressing normal versus oncogenic forms of a receptor.

Identification of a novel point mutation of mouse proto-oncogene c-kit through N-ethyl-N-nitrosourea mutagenesis.

Manipulation of the mouse genome has emerged as an important approach for studying gene function and establishing human disease models. In this study, the mouse mutants were generated through N-ethyl-N-nitrosourea (ENU)-induced mutagenesis in C57BL/6J mice. The screening for dominant mutations yielded several mice with fur color abnormalities. One of them causes a phenotype similar to that shown by dominant-white spotting (W) allele mutants. This strain was named Wads because the homozygous mutant mice are white color, anemic, deaf, and sterile. The new mutation was mapped to 42 cM on chromosome five, where proto-oncogene c-kit resides. Sequence analysis of c-kit cDNA from Wads(m/m) revealed a unique T-to-C transition mutation that resulted in Phe-to-Ser substitution at amino acid 856 within a highly conserved tyrosine kinase domain. Compared with other c-kit mutants, Wads may present a novel loss-of-function or hypomorphic mutation. In addition to the examination of adult phenotypes in hearing loss, anemia, and mast cell deficiency, we also detected some early developmental defects during germ cell differentiation in the testis and ovary of neonatal Wads(m/m) mice. Therefore, the Wads mutant may serve as a new disease model of human piebaldism, anemia, deafness, sterility, and mast cell diseases.

The proto-oncogene C-KIT maps to canid B-chromosomes.

Plant and animal karyotypes sometimes contain variable elements, that are referred to as additional or B-chromosomes. It is generally believed that B-chromosomes lack major genes and represent parasitic and selfish elements of a genome. Here we report, for the first time, the localization of a gene to B-chromosomes of mammals: red fox (Vulpes vulpes) and two subspecies of raccoon dog (Nyctereutes procyonoides). Identification of the proto-oncogene C-KIT on B-chromosomes of two Canidae species that diverged from a common ancestor more than 12.5 million years ago argues against the current view of B-chromosomes. Analyses of fox B-chromosomal C-KIT gene from a flow-sorted fox B-chromosome-specific library revealed the presence of intron-exon boundaries and high identity between sequenced regions of canine and fox B-chromosomal C-KIT copies. Identification of C-KIT gene on ALL B-chromosomes of two canid species provides new insight into the origin and evolution of supernumeraries and their potential role in the genome.

Differences in signaling pathways and expression level of the phosphoinositide phosphatase SHIP1 between two oncogenic mutants of the receptor tyrosine kinase KIT.

Oncogenic mutations of the receptor tyrosine kinase KIT are encountered in myeloid leukemia and various solid tumors, including gastrointestinal stromal tumors. We previously identified the human oncogenic germ line mutant KIT(K642E), a substitution in the tyrosine kinase 1 domain (TK1D) in a familial form of gastrointestinal stromal tumors. The effects of oncogenic KIT mutants on cell signaling and regulation are complex. Cellular models are valuable basic tools to tailor novel strategies on specific cellular and molecular bases for tumors expressing KIT oncogenic mutants. Murine KIT(WT) and the murine homologues of human KIT oncogenic mutants, further referred to as KIT(K641E) and KIT(del559), a point deletion in the juxtamembrane domain (JMD), were stably expressed in IL-3-dependent Ba/F3 cells. Major differences in the constitutively activation of Akt/PKB, MAP kinases and STATs pathways were observed between KIT(K641E) and KIT(del559), whereas KIT ligand elicited responses in both mutants. Noteworthy, the protein level of the phosphoinositide phosphatase SHIP1, but not SHIP2 and PTEN, was reduced in KIT(K641E) only while inhibition of KIT phosphorylation reversibly raised SHIP1 level in both JMD and TK1D oncogenic mutants, unraveling the control of SHIP protein level by KIT phosphorylation.

Putative DNA quadruplex formation within the human c-kit oncogene.

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.

A knock-in mouse model of gastrointestinal stromal tumor harboring kit K641E.

A mouse model of gastrointestinal stromal tumor (GIST) has been developed by a knock-in gene targeting strategy, which introduced a Kit gene K641E mutation, originally identified in sporadic human GISTs and in the germ line of familial GIST syndrome patients. Homozygous and heterozygous Kit K641E mice develop gastrointestinal pathology with complete penetrance and ALL Kit K641E homozygotes die by age 30 weeks due to gastrointestinal obstruction by hyperplastic interstitial cells of Cajal (ICC) or GISTs. Heterozygous mice have less extensive ICC hyperplasia and smaller GISTs, suggesting a dose-response relationship between oncogenically activated Kit and ICC proliferation. Immunoprecipitation and Western blotting reveal GISTs to contain abundant phosphorylated/activated Kit. In addition to ICC hyperplasia and GISTs, homozygous Kit K641E mice exhibit loss-of-function Kit phenotypes, including white coat color, decreased numbers of dermal mast cells, and sterility, indicating that despite its oncogenic activity the mutant form cannot accomplish many activities of the wild-type gene. Kit K641E reproduces the pathology associated with the familial GIST syndrome and thus is an excellent model to study Kit pathway activation, ICC biology, GIST pathogenesis, and preclinical validations of GIST therapies and mechanisms of drug resistance.

KIT (c-kit oncogene product) pathway is constitutively activated in human testicular germ cell tumors.

We investigated the expression of KIT (product of c-kit oncogene), gain-of-function mutations, and activation of its downstream signal transduction in human testicular cancers. KIT was expressed in 88% (22/25) of seminomas and in 44.4% (4/9) of non-seminomas compared to adjacent normal testicular tissue. Nine of the KIT-expressing seminomas had mutations (40.9%; 9/22) in the c-kit gene; two cases in exon 11 and 7 cases in exon 17. Two of these mutations in exon 17 were novel, and the other seven mutations were identical to the already known gain-of-function mutations which cause activation of KIT without ligand stem cell factor. ALL of the mutant KIT and 53.8% (7/13) of wild-type KIT were phosphorylated (activated) and associated with phosphorylated phosphatidylinositol 3-kinase (PI3K). Akt was also phosphorylated in these seminomas, suggesting that the KIT-PI3K-Akt pathway is activated in seminoma. These findings suggest that the KIT-PI3K-Akt pathway is constitutively activated in testicular germ cell tumors, due to overexpression of KIT protein and/or gain-of-function mutations in the c-kit gene.

Mastocytosis in mice expressing human Kit receptor with the activating Asp816Val mutation.

Mastocytosis is a rare neoplastic disease characterized by a pathologic accumulation of tissue mast cells (MCs). Mastocytosis is often associated with a somatic point mutation in the Kit protooncogene leading to an Asp/Val substitution at position 816 in the kinase domain of this receptor. The contribution of this mutation to mastocytosis development remains unclear. In addition, the clinical heterogeneity presented by mastocytosis patients carrying the same mutation is unexplained. We report that a disease with striking similarities to human mastocytosis develops spontaneously in transgenic mice expressing the human Asp816Val mutant Kit protooncogene specifically in MCs. This disease is characterized by clinical signs ranging from a localized and indolent MC hyperplasia to an invasive MC tumor. In addition, bone marrow-derived MCs from transgenic animals can be maintained in culture for >24 mo and acquire growth factor independency for proliferation. These results demonstrate a causal link in vivo between the Asp816Val Kit mutation and MC neoplasia and suggest a basis for the clinical heterogeneity of human mastocytosis.

A conserved quadruplex motif located in a transcription activation site of the human c-kit oncogene.

The c-kit gene encodes a receptor tyrosine kinase, whose engagement by its ligand triggers signals leading to cell proliferation. c-kit activity is elevated in gastrointestinal stromal tumors (GISTs), and its therapeutic inhibition by small molecules such as imatinib is clinically validated. We identified a putative quadruplex forming 21-nucleotide sequence upstream of the c-kit transcription initiation site (c-kit21), on the G-rich strand, which occupies a site required for core promoter activity. Here, we show by nuclear magnetic resonance (NMR), circular dichroism (CD), and ultraviolet (UV) spectroscopic methods that c-kit21 forms quadruplexes under physiological conditions. mutational analysis of c-kit21 has provided insights into its structural polymorphism. In particular, one mutated form appears to form a single quadruplex species that adopts a parallel conformation. The quadruplex-forming sequence shows a high level of sequence conservation across human, mouse, rat, and chimpanzee. The small variation in sequence between the quadruplex in human/chimpanzee as compared to the rat/mouse was examined more closely by biophysical methods. Despite a variation in the sequence and length of loop 2, the quadruplexes showed both comparable CD spectra, indicative of parallel quadruplexes, and also similar thermal-stability profiles, suggesting conservation of biophysical characteristics. Collectively, the evidence suggests that this quadruplex is a serious target for a detailed functional investigation at the cell-biology level.

Expression of c-kit proto-oncogene in canine mastocytoma: a kinetic study using real-time polymerase chain reaction.

KIT receptor, the c-kit gene product, is thought to play a major role in canine mastocytoma, one of the most common neoplastic diseases in dogs. In the present study, the expression of c-kit proto-oncogene in blood and in tumor biopsies from 41 dogs with histologically confirmed mastocytoma at different grades of cellular differentiation and 5 negative control dogs was investigated using real-time (quantitative) reverse transcription-polymerase chain reaction (RRT-PCR). The animals were followed up for over 1 year after surgery in order to characterize the kinetics of c-kit expression in blood. Transcript mRNAs extracted from blood at different time points after surgery and from tumor tissue surgically removed from each dog were used in a quantitative RRT-PCR assay targeting the extracellular coding region of the c-kit gene. Tissues constitutively expressing c-kit (brain and spleen) were used as positive controls. Levels of expression of c-kit were higher in tumor biopsies than in blood; the blood level decreased in the patients between 1 and 3 months after surgery. No KIT expression was detected in blood from the 5 dogs not affected by mastocytoma (negative controls). The RRT-PCR appears to be a suitable method for sensitive and quantitative detection of c-kit gene expression in canine blood and neoplastic tissues. Although c-kit expression levels measured by RRT-PCR do not correlate with prognosis, they confirm that surgery remains the main treatment to reduce circulating mastocytes and that circulating mast cells can be detected even in benign highly differentiated forms of mastocytoma such as grade I.

Identification of a ligand for the c-kit proto-oncogene.

We report the purification and N-terminal amino acid sequence of a novel mast cell growth factor, termed MGF, from the supernatants of a murine stromal cell line. A panel of interleukin 3-dependent cell lines were screened for responsiveness to partially purified MGF in [3H]thymidine incorporation assays; proliferative stimulation of these cells in response to MGF correlated with expression of mRNA for the c-kit protooncogene. MGF was shown to be a ligand for c-kit by cross-linking 125I-labeled MGF to c-kit-expressing cells with subsequent immunoprecipitation of the complex with antiserum specific for the C-terminus of c-kit. This establishes MGF as a ligand for the c-kit protein.

Developmental expression of c-kit, a proto-oncogene encoded by the W locus.

Developmental expression of the c-kit proto-oncogene, a receptor tyrosine kinase encoded by the W locus, was investigated by in situ hybridization in normal mouse embryos. Early after implantation transcripts were detectable only in the maternal placenta (6 1/2-7 1/2 days p.c.). Subsequently (8 1/2 days p.c.) numerous ectodermal (neural tube, sensory placodes) and endodermal (embryonic gut) derivatives expressed c-kit. Later transcripts were detected also in the blood islands of the yolk sac and in the embryonic liver, the main sites of embryonic hemopoiesis. Around midgestation, transcripts accumulated in the branchial pouches and also in primordial germ cells of the genital ridges. This complex pattern of expression remained characteristic also later in gestation, when c-kit was expressed in highly differentiated structures of the craniofacial area, in presumptive melanoblasts and in the CNS. In the adult ovary, maternal c-kit transcripts were detected. They were present in the oocytes of both immature and mature ovarian follicles, but not in the male germ line, where c-kit expression may be down regulated. Thus, c-kit activity is complex and appears in multiple tissues including those that also display defects in mutations at the W locus where c-kit is encoded. Correlation between W phenotypes and c-kit expression, as well as the regulation of the complex and multiple expression of polypeptide growth factors and receptors, is discussed.

Receptor functions and ligand-dependent transforming potential of a chimeric kit proto-oncogene.

The c-kit proto-oncogene, the cellular homolog of the transforming gene of a feline retrovirus, encodes a transmembrane tyrosine kinase homologous to receptors for growth factors. To study the cellular function of c-kit, we constructed a chimeric molecule composed of the extracellular portion of the receptor for epidermal growth factor (EGF) and the transmembrane and cytoplasmic domains of p145kit. The hybrid molecule was properly expressed in murine fibroblasts and displayed specific binding of EGF (Kd, 3 x 10(-8) M). Activation of the chimeric receptor by EGF stimulated the tyrosine kinase activity of kit and led to the generation of a potent mitogenic signal. Moreover, cells expressing the chimeric receptor acquired a transformed phenotype once they were stimulated with the heterologous ligand.

Expression of the c-kit proto-oncogene in the murine male germ cells.

The proto-oncogene c-kit encodes a transmembrane protein tyrosine kinase receptor. The c-kit gene has recently been shown to be allelic with the W locus. mutations at the white spotting locus (W) affect various aspects of hematopoiesis, melanogenesis and gametogenesis during development and in the adult animal. We have investigated the expression of the proto-oncogene c-kit in mouse testicular cell populations. The c-kit mRNA was found to be expressed at high levels in spermatogonia, and at lower levels in meiotic pachytene spermatocytes. Moreover, two novel testis-specific c-kit transcripts of 3.5 and 2.3 kb are present in postmeiotic haploid germ cells. These results suggest a role of c-kit not only during testis development in the embryo, but also throughout ALL stages of male germ cell development after birth.

Effect of murine mast cell growth factor (c-kit proto-oncogene ligand) on colony formation by human marrow hematopoietic progenitor cells.

Purified natural (n) and recombinant (r) murine (mu) mast cell growth factor (MGF, a c-kit ligand) were evaluated alone and in combination with r human (hu) erythropoietin (Epo), rhu granulocyte-macrophage colony-stimulating factor (rhuGM-CSF), rhuG-CSF, and/or rhuM-CSF for effects in vitro on colony formation by multipotential (colony-forming unit-granulocyte, erythroid, monocyte, megakaryocyte [CFU-GEMM]), erythroid (burst-forming unit erythroid [BFU-E]) and granulocyte-macrophage (CFU-GM) progenitor cells from normal human bone marrow. MGF was a potent enhancing cytokine for Epo-dependent CFU-GEMM and BFU-E colony formation, stimulating more colonies and of a larger size than either rhu interleukin-3 (rhuIL-3) or rhuGM-CSF. MGF, especially at lower concentrations, also acted with rhuIL-3 or rhuGM-CSF to enhance Epo-dependent CFU-GEMM and BFU-E colony formation. MGF had little stimulating activity for CFU-GM colonies by itself, but in combination with suboptimal to optimal amounts of rhuGM-CSF enhanced the numbers and the size of CFU-GM colonies in an additive to greater than additive manner. While we did not detect an effect of MGF on CFU-G colony numbers stimulated by maximal concentrations of rhuG-CSF, MGF did enhance the size of CFU-G-derived colonies. MGF did not enhance the activity of rhuM-CSF. In a comparative assay, maximal concentrations of rmu and rhuMGF were equally effective in the enhancement of human bone marrow colony formation, but rhuMGF, in contrast to rmuMGF, did not at the concentrations tested enhance colony formation by mouse bone marrow cells. MGF effects on BFU-E, CFU-GM, and CFU-GEMM may be direct acting ones as MGF-enhanced colony formation by these cells in highly enriched progenitor cell populations of CD34 HLA-DR+ and CD34 HLA-DR+CD33- sorted cells in which greater than or equal to 1 of 2 cells was a BFU-E plus CFU-GM plus CFU-GEMM. MGF appears to be an early acting cytokine that preferentially stimulates the growth of immature hematopoietic progenitor cells.

An SstI RFLP at the C-Kit oncogene locus (KIT).

Purified natural (n) and recombinant (r) murine (mu) mast cell growth factor (MGF, a c-kit ligand) were evaluated alone and in combination with r human (hu) erythropoietin (Epo), rhu granulocyte-macrophage colony-stimulating factor (rhuGM-CSF), rhuG-CSF, and/or rhuM-CSF for effects in vitro on colony formation by multipotential (colony-forming unit-granulocyte, erythroid, monocyte, megakaryocyte [CFU-GEMM]), erythroid (burst-forming unit erythroid [BFU-E]) and granulocyte-macrophage (CFU-GM) progenitor cells from normal human bone marrow. MGF was a potent enhancing cytokine for Epo-dependent CFU-GEMM and BFU-E colony formation, stimulating more colonies and of a larger size than either rhu interleukin-3 (rhuIL-3) or rhuGM-CSF. MGF, especially at lower concentrations, also acted with rhuIL-3 or rhuGM-CSF to enhance Epo-dependent CFU-GEMM and BFU-E colony formation. MGF had little stimulating activity for CFU-GM colonies by itself, but in combination with suboptimal to optimal amounts of rhuGM-CSF enhanced the numbers and the size of CFU-GM colonies in an additive to greater than additive manner. While we did not detect an effect of MGF on CFU-G colony numbers stimulated by maximal concentrations of rhuG-CSF, MGF did enhance the size of CFU-G-derived colonies. MGF did not enhance the activity of rhuM-CSF. In a comparative assay, maximal concentrations of rmu and rhuMGF were equally effective in the enhancement of human bone marrow colony formation, but rhuMGF, in contrast to rmuMGF, did not at the concentrations tested enhance colony formation by mouse bone marrow cells. MGF effects on BFU-E, CFU-GM, and CFU-GEMM may be direct acting ones as MGF-enhanced colony formation by these cells in highly enriched progenitor cell populations of CD34 HLA-DR+ and CD34 HLA-DR+CD33- sorted cells in which greater than or equal to 1 of 2 cells was a BFU-E plus CFU-GM plus CFU-GEMM. MGF appears to be an early acting cytokine that preferentially stimulates the growth of immature hematopoietic progenitor cells.

Expression of the YB5.B8 antigen (c-kit proto-oncogene product) in normal human bone marrow.

The c-kit proto-oncogene product is a member of the family of growth factor receptors with intrinsic tyrosine kinase activity. In the mouse c-kit maps to the W locus, which is known to be of central importance in hematopoiesis. Monoclonal antibody (MoAb) YB5.B8, which was raised against peripheral blood blast cells from a patient with acute myeloid leukemia (AML), was recently shown to bind to the extracellular domain of the c-kit product. This antibody does not bind detectably to normal peripheral blood cells and identifies a sub-group of AML patients with poor prognosis. We have used MoAb YB5.B8 to study the expression of c-kit by normal human bone marrow cells by immunofluorescence and flow cytometry, and to isolate multipotential and erythroid colony-forming cells. In a series of 11 normal adult bone marrow specimens, MoAb YB5.B8 bound to 4.0% +/- 1.8% of the cells in the low-density fraction. Dual-labeling experiments were performed with YB5.B8, and CD33, CD34, and CD10 MoAbs. Three populations of cells binding YB5.B8 could be identified based on their pattern of coexpression of the other markers; ie, YB5.B8+/CD34+/CD33-, YB5.B8+/CD34+/CD33+ and YB5.B8+/CD34+/CD33+. These populations had distinctive two-dimensional light scatter characteristics and are likely to correspond to precursor colony-forming cells, colony-forming cells, and maturing mast cells, respectively. No cells binding both YB5.B8 and an MoAb to the early lymphoid marker CD10 were found, implying that most early lymphoid cells do not express c-kit. MoAbs to the c-kit protein should prove valuable in multimarker studies of human hematopoietic stem and progenitor cells. Definition of a reference range of c-kit expression in normal human bone marrow will provide a sound basis for further studies of this marker in diagnosis and prognosis in AML.

Semaxinib (SU5416) as a therapeutic agent targeting oncogenic Kit mutants resistant to imatinib mesylate.

Activating mutations in the Kit receptor are frequently observed in various malignancies, pointing Kit as a molecule of interest for drug inhibition. When mutated on Asp 816 (corresponding to Asp 814 in the mouse), as preferentially found in human mastocytosis and acute myeloid leukemia, Kit became non-sensitive to imatinib mesylate (Gleevec). Erythroleukemic cells isolated from Spi-1/PU.1 transgenic mice express Kit mutated at codon 814 (Kit(D814Y) or Kit(D814V)) or codon 818 (Kit(D818Y)). Using these cells in vitro, we demonstrate that the tyrosine kinase inhibitor SU5416 (Semaxinib) induces growth arrest and apoptosis independent of the mutation type by inhibiting the functions of Kit, including Kit autophosphorylation and activation of Akt, Erk1/Erk2 and Stat3 downstream signaling pathways. These findings indicate that SU5416 may be a promising tool to kill cancer cells driven by Kit oncogenic mutations that are resistant to treatment with imatinib mesylate.

Proliferation of human myeloid leukemia cell line associated with the tyrosine-phosphorylation and activation of the proto-oncogene c-kit product.

We investigated the expression, degree of phosphorylation, and activation of the proto-oncogene c-kit product before and after stimulation with the c-kit ligand in a human factor-dependent myeloid leukemia cell line, MO7E. The culture supernatant of the BALB/3T3 fibroblast cell line, which contains the ligand for the murine c-kit product, was found to stimulate proliferation of the MO7E cell line in a dose-dependent manner. The proliferation was significantly inhibited by a tyrosine kinase inhibitor, genistein. An immunoblot technique with a monoclonal antibody specific for phosphotyrosine, showed that there was rapid, dose-dependent tyrosine-phosphorylation of the c-kit product in response to murine c-kit ligand. Furthermore, the murine c-kit ligand increased autokinase activity of the c-kit product in vitro. Similar results were obtained with human stem cell factor (SCF), a recombinant human ligand for the c-kit product. These results suggest that the phosphorylation and activation of the c-kit product are involved in proliferative signals of some human leukemia cells, as well as of normal hematopoietic cells.

Expression and functional role of the proto-oncogene c-kit in acute myeloblastic leukemia cells.

The c-kit proto-oncogene encodes a receptor tyrosine kinase that is thought to play an important role in hematopoiesis. In a series of human acute myeloblastic leukemia (AML), the expression of the c-kit proto-oncogene and its product was studied by means of Northern blot and immunoblot analyses. The c-kit mRNA was expressed in 20 of 25 cases of AML, and in those cases the product of the c-kit proto-oncogene was detected by immunoblotting with anti-c-kit antibody. The expression of c-kit transcripts and protein was barely detectable in normal bone marrow cells as a control. The expression of c-kit transcript did not correlate with the French-American-British classification nor clinical manifestations. In 6 of 11 cases that expressed c-kit product, AML cells were found to proliferate in response to recombinant human stem cell factor (rhSCF), the ligand for c-kit, and the synergistic stimulation of AML cells was observed by rhSCF and granulocyte-macrophage colony-stimulating factor. Immunoblotting with anti-phosphotyrosine antibody showed that the c-kit receptor protein was detectably phosphorylated in 7 of 12 cases tested before the stimulation with rhSCF, while the rhSCF treatment resulted in an increased tyrosine phosphorylation of c-kit in AML cells. These results indicate that c-kit proto-oncogene is expressed in most cases of AML and is functional in terms of supporting proliferation.

The product of the proto-oncogene c-kit (P145c-kit) is a human bone marrow surface antigen of hemopoietic precursor cells which is expressed on a subset of acute non-lymphoblastic leukemic cells.

A monoclonal antibody (17F11) was raised by immunization of a Balb/c mouse with leukemic blasts from a patient with acute non-lymphocytic leukemia (ANLL). This antibody recognizes most leukemic blasts of myeloid but not of lymphoid lineage and no peripheral blood cells. By screening NIH-3T3 fibroblasts transfected with the human proto-oncogene c-kit (NIH-3T3/hckit) it could be shown that 17F11 specifically recognizes the gene product P145c-kit. Immunofluorescence analysis on normal hemopoietic cells revealed that 17F11 weakly stains 1-3% of bone marrow mononuclear cells (BMMNC). By FACS sorting and colony assays it could be shown that granulocyte--macrophage progenitor cells could be enriched 10-20-fold, granulocyte progenitors 50-80-fold, and erythroid and multipotential progenitor cells 15-20-fold, in the 17F11 positive fraction. Double fluorescence analysis revealed that P145c-kit is co-expressed on 40-60% of the CD34 positive BMMNC. Finally, these data show that P145c-kit is expressed on blast cells from most patients with ANLL (26/30) and chronic myeloid leukemia in blast crisis (7/9), but is absent on blasts from patients with acute lymphoblastic leukemia expressing the T-, B-lineage, or common ALL phenotypes.

Expression of c-KIT oncoprotein in gastrointestinal stromal tumors in adults and children: guideline for diagnosis and treatment.

Gastrointestinal stromal tumors (GISTs) represent a distinct oncogenetic entity that is now center stage in clinical trials of kinase-targeted therapies. These neoplasms express the c-KIT oncoprotein and occur predominantly in adults, more rarely in children. Two selected cases of GIST expressing c-KIT, including one adult patient and a 9-year-old boy are presented. The adult patient was admitted for palpable abdominal mass without other clinical symptoms. On biopsies obtained by scanner-guided procedure, diagnosis of ganglioneurinoma was proposed with the remark that GIST tumor could not be categorically excluded. At surgery, voluminous encapsulated tumor located at the jejunal wall was found and totally excised. The second patient presented with acute upper gastrointestinal hemorrhage associated with several months history of general fatigue and loss of appetite. Computed tomography (CT) and magnetic resonance imaging (MRI) showed a tumoral mass arising from the lesser curvature of the stomach compatible with GIST. Two small metastatic lesions in the liver were also detected. Combined treatment by surgery and systemic therapy by the tyrosine kinase inhibitor imatinib mesylate was applied.

IL-4 regulates c-kit proto-oncogene product expression in human mast and myeloid progenitor cells.

The c-kit proto-oncogene encodes the receptor for a novel hemopoietic cytokine, termed stem cell factor (SCF) or mast cell growth factor (MGF) according to its stimulating spectrum. The human receptor for SCF/MGF is expressed in a subset of normal bone marrow progenitor cells, in leukemic myeloid cells, and in mast cells. In the present study, the effects of recombinant human growth regulators (IL-1 through -9, granulocyte-macrophage/granulocyte/macrophage-CSF, IFN, and TNF) on c-kit proto-oncogene product expression were analyzed by indirect immunofluorescence, by using the anti-SCF/MGFR mAb YB5.B8, and Northern blot analyses, by using a c-kit oligonucleotide probe. Of ALL cytokines tested, IL-4 was found to down-regulate expression of YB5.B8 Ag in the human mast cell line HMC-1 (maximum inhibition, 51.05 +/- 16.36% mean fluorescence intensity of control; p less than 0.02), as well as in primary leukemic myeloid cells. IL-4 was also found to down-regulate expression of YB5.B8 Ag in normal enriched bone marrow progenitor cells. The effects of IL-4 on expression of YB8.B8 Ag in myeloid/mast cell progenitors was dose and time dependent (maximum effects observed on days 2 and/or 4, by using 50 U/ml of rIL-4) and could be neutralized by using anti-IL-4 mAb. Moreover, IL-4 was found to down-regulate expression of c-kit mRNA in leukemic myeloid cells as well as in HMC-1 cells. Together, these observations identify IL-4 as a regulator of c-kit proto-oncogene product expression in the human system. The effects of IL-4 on human hemopoietic progenitor cells and mast cells may be mediated in part through regulation of SCF/MGFR expression.

TaqI RFLP at the c-kit oncogene locus (KIT).

We have isolated and characterized a cDNA which contains the entire coding sequence of Xenopus laevis raf protein. raf mRNA is identified as a member of the class of maternal RNAs. It is already relatively abundant at the beginning of oogenesis and is stable at least until the midblastula transition. The RNA is also detected later during embryogenesis in particular in gastrula, neurula, tailbud and feeding tadpole. We have also found the RNA in several adult tissues (skin, testis, stomach, intestine) at different levels.

Merkel cell carcinoma: evaluation of KIT (CD117) expression and failure to demonstrate activating mutations in the C-KIT proto-oncogene - implications for treatment with imatinib mesylate.

BACKGROUND: Merkel cell carcinomas (MCCs) express the tyrosine kinase receptor KIT. However, it is not known if MCCs have activating mutations in KIT that would make them responsive to treatment with imatinib mesylate. The purpose of this article is to describe the KIT immunohistological staining pattern (CD117) of MCCs and analyze those MCCs for mutations in areas of KIT where mutations are found in gastrointestinal stromal cell tumors. METHODS: We evaluated KIT immunostaining in nine MCCs from nine patients. In addition, we extracted DNA from the same MCCs, performed PCR amplification of C-KIT exons 9, 11, 13, and 17, and sequenced those gene products for mutations. RESULTS: Eight of nine (88.8%) MCCs expressed KIT. No mutations were found. CONCLUSIONS: The majority of MCCs express KIT but do not contain activating mutations in exons 9, 11, 13, or 17 of KIT. Imatinib mesylate is unlikely to provide effective therapy in MCC unless activating mutations in other areas of KIT or activating mutations in other related genes can be detected.

KIT oncoprotein interactions in gastrointestinal stromal tumors: therapeutic relevance.

Most gastrointestinal stromal tumors (GISTs) express oncogenic and constitutively active forms of the KIT or platelet-derived growth factor receptor alpha (PDGFRA) receptor tyrosine kinase proteins, and these kinase oncoproteins serve as targets for effective therapies. Given that mutant KIT oncoproteins serve crucial transforming roles in GISTs, we evaluated interactions with the KIT oncoproteins and determined signaling pathways that are dependent on KIT oncogenic activation in GISTs. Tyrosine-phosphorylated KIT oncoproteins interacted with PDGFRA, PDGFRB, phosphatidylinositol 3-kinase (PI3-K) and PKCtheta in GIST cells, and these interactions were abolished by KIT inhibition with imatinib or PKC412 or KIT RNAi. Notably, tyrosine-phosphorylated PDGFRA was prominent in frozen GIST tumors expressing KIT oncoproteins, suggesting that KIT-mediated PDGFRA phosphorylation is an efficient and biologically consequential mechanism in GISTs. Activated signaling intermediates were identified by immunoaffinity purification of tyrosine-phosphorylated proteins in GIST cells before and after treatment with KIT inhibitors, and these analyses show that GRB2, SHC, CBL and MAPK activation are largely KIT dependent in GISTs, whereas PI3-K, STAT1 and STAT3 activation are partially KIT dependent. In addition, we found that phosphorylation of several tyrosine kinase proteins - including JAK1 and EPHA4 - did not depend on KIT activation. Likewise, paxillin activation was independent of the KIT oncogenic signal. These studies identify signaling pathways that can provide both KIT-dependent and KIT-independent therapeutic synergies in GIST, and thereby highlight clinical strategies that might consolidate GIST therapeutic response to KIT/PDGFRA inhibition.

Sensitivity of human cells bearing oncogenic mutant kit isoforms to the novel tyrosine kinase inhibitor INNO-406.

The activity of the novel tyrosine kinase inhibitor INNO-406 against human cells with mutated KIT was investigated. Human mast cell (HMC)-1.1 cells with juxtamembrane domain mutation V560G, and HMC-1.2 cells with both V560G and the kinase domain mutation D816V, were treated with INNO-406 (0.02-5.00 microM) or imatinib for 72 h. INNO-406 and imatinib were equipotent against HMC-1 cells regarding cell proliferation (IC50 51 nM and 75 nM, respectively), inhibition of KIT phosphorylation, and induction of apoptosis. In contrast, neither drug was effective against HMC-1.2 cells at the dose range tested. The present results suggest clinical potential for INNO-406 in KIT V560G-expressing malignancies.

Single-molecule conformational analysis of G-quadruplex formation in the promoter DNA duplex of the proto-oncogene c-kit.

The activity of the novel tyrosine kinase inhibitor INNO-406 against human cells with mutated KIT was investigated. Human mast cell (HMC)-1.1 cells with juxtamembrane domain mutation V560G, and HMC-1.2 cells with both V560G and the kinase domain mutation D816V, were treated with INNO-406 (0.02-5.00 microM) or imatinib for 72 h. INNO-406 and imatinib were equipotent against HMC-1 cells regarding cell proliferation (IC50 51 nM and 75 nM, respectively), inhibition of KIT phosphorylation, and induction of apoptosis. In contrast, neither drug was effective against HMC-1.2 cells at the dose range tested. The present results suggest clinical potential for INNO-406 in KIT V560G-expressing malignancies.

Molecular alterations of KIT oncogene in gliomas.

Gliomas are the most common and devastating primary brain tumours. Despite therapeutic advances, the majority of gliomas do not respond either to chemo or radiotherapy. KIT, a class III receptor tyrosine kinase (RTK), is frequently involved in tumourigenic processes. Currently, KIT constitutes an attractive therapeutic target. In the present study we assessed the frequency of KIT overexpression in gliomas and investigated the genetic mechanisms underlying KIT overexpression. KIT (CD117) immunohistochemistry was performed in a series of 179 gliomas of various grades. KIT activating gene mutations (exons 9, 11, 13 and 17) and gene amplification analysis, as defined by chromogenic in situ hybridization (CISH) and quantitative real-time PCR (qRT-PCR) were performed in CD117 positive cases. tumour cell immunopositivity was detected in 15.6% (28/179) of cases, namely in 25% (1/4) of pilocytic astrocytomas, 25% (5/20) of diffuse astrocytomas, 20% (1/5) of anaplastic astrocytomas, 19.5% (15/77) of glioblastomas and one third (3/9) of anaplastic oligoastrocytomas. Only 5.7% (2/35) of anaplastic oligodendrogliomas showed CD117 immunoreactivity. No association was found between tumour CD117 overexpression and patient survival. In addition, we also observed CD117 overexpression in endothelial cells, which varied from 0-22.2% of cases, being more frequent in high-grade lesions. No KIT activating mutations were identified. Interestingly, CISH and/or qRT-PCR analysis revealed the presence of KIT gene amplification in 6 glioblastomas and 2 anaplastic oligoastrocytomas, corresponding to 33% (8/24) of CD117 positive cases. In conclusion, our results demonstrate that KIT gene amplification rather than gene mutation is a common genetic mechanism underlying KIT expression in subset of malignant gliomas. Further studies are warranted to determine whether glioma patients exhibiting KIT overexpression and KIT gene amplification may benefit from therapy with anti-KIT RTK inhibitors.

Expression of c-kit proto-oncogene product in breast cancer tissues.

BACKGROUND: The published results on expression of c-kit in benign and malignant breast tissues vary. MATERIALS AND METHODS: The immunohistochemical expression of c-kit proto-oncogene product in 52 invasive breast cancer tissues and 16 benign breast tumor (fibroadenoma) tissues was studied using anti-c-kit proto-oncogene product antibody. Its expression was evaluated by immunoreactive score (IRS). RESULTS: In breast cancer tissues, the mean IRS of c-kit proto-oncogene product expression was significantly increased compared to those of fibroadenoma (3.4 +/- 2 and 2.19 +/- 1.8, respectively,p = 0.035). The mean IRS of c-kit expression was higher in the group comprising estrogen (ER) positive tumor than in the group of ER negative (4.1 +/- 2.1 and 2.7 +/- 1.8, respectively,p = 0.012) but no statistically significant relationship was seen between the expression of c-kit proto-oncogene product and other clinicopathological parameters of breast cancer, including histologic type, tumor size, lymph node metastasis, distant metastasis, stage, progesterone receptor, c-erbB-2 expression, menopausal status and age of the patient (p > 0.05). CONCLUSIONS: Our results show that a high level of c-kit expression occurs frequently in invasive breast cancer, and its expression is associated with ER but unrelated to other clinico-pathological variables.

Trisubstituted isoalloxazines as a new class of G-quadruplex binding ligands: small molecule regulation of c-kit oncogene expression.

The nuclear proteins TAL1 (T-cell acute leukaemia protein 1) and LMO2 (LIM-only protein 2) have critical roles in haematopoietic development, but are also often aberrantly activated in T-cell acute lymphoblastic leukaemia. TAL1 and LMO2 operate within multifactorial protein-DNA complexes that regulate gene expression in the developing blood cell. TAL1 is a tissue-specific basic helix-loop-helix (bHLH) protein that binds bHLH domains of ubiquitous E-proteins, (E12 and E47), to bind E-box (CANNTG) DNA motifs. TAL1(bHLH) also interacts specifically with the LIM domains of LMO2, which in turn bind Ldb1 (LIM-domain binding protein 1). Here we used biophysical methods to characterize the assembly of a five-component complex containing TAL1, LMO2, Ldb1, E12, and DNA. The bHLH domains of TAL1 and E12 alone primarily formed helical homodimers, but together preferentially formed heterodimers, to which LMO2 bound with high affinity (K(A) approximately 10(8) M(-1)). The resulting TAL1/E12/LMO2 complex formed in the presence or absence of DNA, but the different complexes preferentially bound different Ebox-sequences. Our data provide biophysical evidence for a mechanism, by which LMO2 and TAL1 both regulate transcription in normal blood cell development, and synergistically disrupt E2A function in T-cells to promote the onset of leukaemia.

KIT regulates tyrosine phosphorylation and nuclear localization of beta-catenin in mast cell leukemia.

Gain-of-function mutations in the proto-oncogene c-kit that induce constitutive kinase activity of its product, KIT protein, are characteristic of human mast cell disease and are believed to play a central role in mast cell leukemia oncogenesis, proliferation and survival. Nuclear overexpression of the Wnt effector beta-catenin and deregulated beta-catenin nuclear signaling can promote malignant transformation in solid tumors and hematologic malignancies. However, a role for beta-catenin in mast cell leukemia has not been described. Nuclear accumulation of beta-catenin is upregulated by its tyrosine phosphorylation, a process that can be exacerbated by deregulated expression of oncogenic tyrosine kinases. Here, we investigated the relationship between activated KIT and beta-catenin signaling in mast cell leukemia. Beta-catenin was tyrosine-phosphorylated in cells with KIT activated by either gain-of-function mutation or incubation with the KIT ligand stem cell factor. Beta-catenin tyrosine phosphorylation depended on KIT activity but not on PI3K-AKT activation. Tyrosine phosphorylation of beta-catenin was associated with its nuclear localization and enhanced transcription of target genes c-myc and cyclin D1. Endogenous KIT and beta-catenin were found to associate in mast cell leukemia cells, and in vitro kinase assay demonstrated that active KIT phosphorylates tyrosine residues of beta-catenin directly. Aberrant beta-catenin-driven transcription caused by deregulated KIT may represent a significant new target for treatment of mast cell leukemia.

C-kit protein expression correlated with activating mutations in KIT gene in oral mucosal melanoma.

C-kit is a trans-membrane receptor tyrosine kinase (RTK) encoded by the proto-oncogene KIT located at 4q11-12. Gain-of-function mutations arising to c-kit activation independent of its ligand were observed in various tumors related to germ cells, mast cells, and interstitial cells of Cajal. C-kit also participates in melanocyte development; hence, its involvement in oral mucosal melanoma (OMM) tumorigenesis was investigated. Immunohistochemistry and mutation analysis were performed using 18 cases of human primary OMM. Results revealed 16 cases positive to c-kit protein. Atypical melanocytes expressed c-kit. ALL in situ components expressed c-kit, but only four cases exhibited intense expression in the invasive component. Missense mutations were observed in four cases, and two of those correlated with increased protein expression. C-kit expression in atypical melanocytes suggests the role of c-kit in the early stage of OMM tumorigenesis. C-kit protein expression correlated with activating mutations indicating the pertinent role of the proto-oncogene KIT in the tumorigenesis of OMM.

Ezrin is a target for oncogenic Kit mutants in murine erythroleukemia.

The model of erythroleukemia caused by Spi-1/PU.1 transgenesis in mice is a multistage disease. A preleukemic step is characterized by an acute proliferation of proerythroblasts due to the arrest of differentiation provoked by Spi-1/PU.1. Later on, a blastic crisis occurs associated with somatic oncogenic mutations in the stem cell factor (SCF) receptor kit. To gain insights into the mechanisms of the leukemic progression, we performed proteomic profiling analyses of proerythroblasts isolated at the 2 stages of the disease. Our results indicate that the level of ezrin, a membrane cytoskeletal crosslinker, is increased in the leukemic cells. We show that Kit oncogenic forms are responsible for ezrin phosphorylation and that phosphorylation rather than overexpression is essential in the leukemic proerythroblasts. Using expression of dominant-negative forms of ezrin, we show that phosphorylation of ezrin on residue Y353 participates in apoptosis resistance, whereas phosphorylation on residue Y145 promotes proliferation of the leukemic cells in vitro and in vivo. Another recurrent oncogenic form of tyrosine kinases (Flt3) most frequently involved in human myeloid leukemia was also able to phosphorylate ezrin. These findings point to a new role for ezrin as signaling player in the development of leukemia, being a downstream effector of oncogenic tyrosine kinases in leukemic blasts.

Expression of proto-oncogene C-kit and correlation with morphological evaluations in canine cutaneous mast cell tumors.

Canine cutaneous mast cell tumor (MCT) is very common disease in dogs, this is more aggressive than in other species. The biologic behavior of MCT is highly variable and a more accurate prognosis for these tumors needs to performed. The proto-oncogene c-kit is known to play a critical role in development and function of mast cells (MC). The aim of this study was to evaluate the expression of immunohistochemical pattern of c-kit in MCTs and to correlate these results with MC density (MCD) and intratumoral microvessel density (MVD). Our results confirm that a more aggressive biologic behavior of canine MCT is associated with the increased c-kit expression, further suggesting a new role for c-kit, as a useful marker, in diagnostic pathology and in tumor progression.

Identification of a novel subgroup of melanomas with KIT/cyclin-dependent kinase-4 overexpression.

Although many melanomas harbor either activating mutations in BRAF or NRAS, there remains a substantial, yet little known, group of tumors without either mutation. Here, we used a genomic strategy to define a novel group of melanoma cell lines with co-overexpression of cyclin-dependent kinase 4 (CDK4) and KIT. Although this subgroup lacked any known KIT mutations, they had high phospho-KIT receptor expression, indicating receptor activity. Quantitative PCR confirmed the existence of a similar KIT/CDK4 subgroup in human melanoma samples. Pharmacologic studies showed the KIT/CDK4-overexpressing subgroup to be resistant to BRAF inhibitors but sensitive to imatinib in both in vitro and in vivo melanoma models. Mechanistically, imatinib treatment led to increased apoptosis and G(1) phase cell cycle arrest associated with the inhibition of phospho-ERK and increased expression of p27(KIP). Other melanoma cell lines, which retained some KIT expression but lacked phospho-KIT, were not sensitive to imatinib, suggesting that KIT expression alone is not predictive of response. We suggest that co-overexpression of KIT/CDK4 is a potential mechanism of oncogenic transformation in some BRAF/NRAS wild-type melanomas. This group of melanomas may be a subpopulation for which imatinib or other KIT inhibitors may constitute optimal therapy.

Oncogenic and ligand-dependent activation of KIT/PDGFRA in surgical samples of imatinib-treated gastrointestinal stromal tumours (GISTs).

As the range of receptor tyrosine kinase (RTK) inhibitors widens, a detailed understanding of the activating mechanisms of KIT/platelet-derived growth factor receptor (PDGFR)A and the related downstream pathways involved in the development and maintenance of GISTs is becoming increasingly important. We analysed areas with different histological response ratios in surgical specimens taken from imatinib-treated and untreated GIST patients in order to investigate KIT and PDGFRA expression/activation, the presence of their cognate ligands and the activation of downstream signalling, by means of biochemistry, immunohistochemistry and flow cytometry. ALL of the cases showed KIT and PDGFRA co-expression. In addition to the oncogenic activation of mutated receptors, activation of wild-type KIT and wild-type PDGFRA, sustained by heterodimerization and an autocrine-paracrine loop, was demonstrated by the presence of their specific ligands, stem cell factor (SCF) and PDGFA. To confirm RTK activation further, ALL of the samples (including those with the highest regression ratios) were investigated for downstream effectors, and ALL proved to have activated downstream signalling. The results show that after the mutated receptors are switched off, heterologous wild-type receptors become important in imatinib-treated GISTs as a means of maintaining signalling activation. Taken together, our findings suggest that drugs targeting wild-type receptors should be tested in imatinib-treated GIST patients.

Imatinib targeting of KIT-mutant oncoprotein in melanoma.

PURPOSE: Melanoma subtypes based on anatomic location and UV light exposure can be further classified based on genetic alterations recently identified. mutations and gene amplification in KIT have been described in a significant percentage of mucosal and acral melanomas. We recently reported a patient with metastatic mucosal melanoma harboring a known KIT mutation treated with imatinib mesylate who experienced a major response. Biological effects of KIT inhibition in these melanomas remain poorly understood. We sought to investigate further the effects of imatinib in these melanoma subsets. EXPERIMENTAL DESIGN: Mucosal melanoma cells were analyzed for KIT aberrations by genomic sequencing, quantitative PCR, and single nucleotide polymorphism analyses. Imatinib effects were assayed by viability measurements and apoptotic cytotoxicity. tumor cell lysates were assayed by Western blots to determine effects on multiple signaling pathways after imatinib exposure. RESULTS: Mucosal melanoma cells exhibited imatinib sensitivity correlating with KIT mutational status. Imatinib dramatically decreased proliferation and was cytotoxic to a KIT mutated and amplified cell culture. Exposure to drug affected the mitogen-activated protein kinase, phosphatidylinositol 3-kinase/AKT, JAK-STAT, and antiapoptotic pathways. CONCLUSIONS: Rational targeting of KIT in melanoma offers a unique and potent clinical opportunity. In vitro analyses revealed major sensitivity to KIT kinase inhibition by imatinib, with potent induction of melanoma cell apoptosis. Biochemical studies identified changes in signaling molecules regulating proliferation and survival responses, which may serve as mediators and/or biomarkers of in vivo treatment efficacy. pathways affected by KIT inhibition provide a model for understanding components in effective melanoma cell death and insights into targeting for resistance mechanisms.

c-KIT signaling as the driving oncogenic event in sub-groups of melanomas.

As we enter the era of targeted therapy for melanoma, attempts are being made to sub-group tumors on the basis of their driving oncogenic mutations, with the hope of developing truly personalized therapeutic regimens. c-KIT is a receptor tyrosine kinase whose aberrant activation is implicated in the progression of gastrointestinal stromal tumors and some acute myeloid leukemias. The role of c-KIT signaling in melanoma has been controversial; although c-KIT activity is critical to melanocyte development, its expression tends to be lost in most melanomas. Some reports have even shown that the re-expression of c-KIT induces apoptosis in melanoma cell lines. The recent publication of work showing the presence of activating c-KIT mutations in acral and mucosal melanomas, as well as melanomas arising on skin with chronic sun damage, has renewed interest in c-KIT signaling in melanoma. Recent work from our own laboratory has further identified melanomas with constitutive c-KIT signaling activity resulting from c-KIT receptor overexpression. Although the initial clinical trials of the c-KIT inhibitor imatinib mesylate in melanoma were negative, some dramatic responses have been seen in patients with very high c-KIT expression and/or documented activating mutations, fostering the belief that focused studies in patients selected on the basis of c-KIT mutational status will yield more encouraging results. The current review discusses the role of c-KIT signaling in melanoma progression and how this new information can be applied to the targeted therapy of melanoma.

Kit K641E oncogene up-regulates Sprouty homolog 4 and trophoblast glycoprotein in interstitial cells of Cajal in a murine model of gastrointestinal stromal tumours.

Gastrointestinal stromal tumours (GIST) are thought to derive from the interstitial cells of Cajal (ICC) or an ICC precursor. Oncogenic mutations of the receptor tyrosine kinase KIT are present in most GIST. KIT K642E was originally identified in sporadic GIST and later found in the germ line of a familial GIST cohort. A mouse model harbouring a germline Kit K641E mutant was created to model familial GIST. The expression profile was investigated in the gastric antrum of the Kit(K641E) murine GIST model by microarray, quantitative PCR and immunofluorescence. Gja1/Cx43, Gpc6, Gpr133, Pacrg, Pde3a, Prkar2b, Prkcq/Pkce, Rasd2, Spry4 and Tpbg/5T4 were found to be up-regulated. The proteins encoded by Gja1/Cx43, Pde3a, Prkcq/Pkce were localized in Kit-ir ICC in wild-type and Kit(K641E) animals while Spry4 and Tpbg/5T4 were detected in Kit-ir cells only in Kit(K641E), but not in Kit(WT/WT) animals. Most up-regulated genes in this mouse model belong to the gene expression profile of human GIST but also to the profile of normal Kit(+) ICC in the mouse small intestine. Spry4 and Tpbg/5T4 may represent candidates for targeted therapeutic approaches in GIST with oncogenic KIT mutations.

Oncogenic signaling from the hematopoietic growth factor receptors c-Kit and Flt3.

Signal transduction in response to growth factors is a strictly controlled process with networks of feedback systems, highly selective interactions and finely tuned on-and-off switches. In the context of cancer, detailed signaling studies have resulted in the development of some of the most frequently used means of therapy, with several well established examples such as the small molecule inhibitors imatinib and dasatinib in the treatment of chronic myeloid leukemia. Impaired function of receptor tyrosine kinases is implicated in various types of tumors, and much effort is put into mapping the many interactions and downstream pathways. Here we discuss the hematopoietic growth factor receptors c-Kit and Flt3 and their downstream signaling in normal as well as malignant cells. Both receptors are members of the same family of tyrosine kinases and crucial mediators of stem-and progenitor-cell proliferation and survival in response to ligand stimuli from the surrounding microenvironment. Gain-of-function mutations/alterations render the receptors constitutively and ligand-independently activated, resulting in aberrant signaling which is a crucial driving force in tumorigenesis. Frequently found mutations in c-Kit and Flt3 are point mutations of aspartic acid 816 and 835 respectively, in the activation loop of the kinase domains. Several other point mutations have been identified, but in the case of Flt3, the most common alterations are internal tandem duplications (ITDs) in the juxtamembrane region, reported in approximately 30% of patients with acute myeloid leukemia (AML). During the last couple of years, the increasing understanding of c-Kit and Flt3 signaling has also revealed the complexity of these receptor systems. The impact of gain-of-function mutations of c-Kit and Flt3 in different malignancies is well established and shown to be of clinical relevance in both prognosis and therapy. Many inhibitors of both c-Kit or Flt3 or of their downstream substrates are in clinical trials with encouraging results, and targeted therapy using a combination of such inhibitors is considered a promising approach for future treatments.

A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics.

Guanine-rich DNA sequences with the ability to form quadruplex structures are enriched in the promoter regions of protein-coding genes, particularly those of proto-oncogenes. G-quadruplexes are structurally polymorphic and their folding topologies can depend on the sample conditions. We report here on a structural study using solution state NMR spectroscopy of a second G-quadruplex-forming motif (c-kit2) that has been recently identified in the promoter region of the c-kit oncogene. In the presence of potassium ions, c-kit2 exists as an ensemble of structures that share the same parallel-stranded propeller-type conformations. Subtle differences in structural dynamics have been identified using hydrogen-deuterium exchange experiments by NMR spectroscopy, suggesting the coexistence of at least two structurally similar but dynamically distinct substates, which undergo slow interconversion on the NMR timescale.

The aberrant localization of oncogenic kit tyrosine kinase receptor mutants is reversed on specific inhibitory treatment.

Kit is a cell surface type III tyrosine kinase (TK) receptor implicated in cell transformation through overexpression or oncogenic mutation. Two categories of Kit mutants displaying mutations either in the juxtamembrane intracellular domain (regulatory mutants) or in the catalytic domain (catalytic mutants) have been described. To explore the effect of Kit oncogenic mutations on its subcellular localization, we constructed enhanced green fluorescent protein (EGFP)-tagged human Kit chimeras harboring mutations either in the regulatory (V560G) or in the catalytic (D816V) domain. When expressed in Chinese hamster ovary cells, EGFP-tagged wild-type Kit was activated on stem cell factor stimulation, whereas both EGFP-tagged Kit mutants displayed a constitutive TK activity. Constitutively activated mutants exhibited a high-mannose-type N-glycosylation pattern and an intracellular localization, suggesting that these mutants induce downstream oncogenic signaling without the need to reach the cell surface. Inhibition of constitutive Kit TK activity with dasatinib induced a complex, mature N-glycosylation pattern identical to unstimulated wild-type Kit and resulted in the redistribution of the mutants to the plasma membrane. This relocalization was clearly correlated to the inhibition of TK activity because imatinib, a specific inhibitor of the V560G mutant, inactive on the catalytic D816V mutant, induced only the relocalization of the V560G mutant. These data show that on TK inhibition, the aberrant localization of Kit mutants can be fully reversed. Kit mutants are then exported and/or stabilized at the cell surface as inactive and fully N-glycosylated isoforms.

Amplification of chromosomal segment 4q12 in non-small cell lung cancer.

In cancer, proto-oncogenes are often altered by genomic amplification. Here we report recurrent focal amplifications of chromosomal segment 4q12 overlapping the proto-oncogenes PDGFRA and KIT in non-small cell lung cancer (NSCLC). Single nucleotide polymorphism (SNP) array and fluorescent in situ hybridization (FISH) analysis indicate that 4q12 is amplified in 3-7% of lung adenocarcinomas and 8-10% of lung squamous cell carcinomas. In addition, we demonstrate that the NSCLC cell line NCI-H1703 exhibits focal amplification of PDGFRA and is dependent on PDGFRalpha activity for cell growth. Treatment of NCI-H1703 cells with PDGFRA-specific shRNAs or with the PDGFRalpha/KIT small molecule inhibitors imatinib or sunitinib leads to cell growth inhibition. However, these observations do not extend to NSCLC cell lines with lower-amplitude and broader gains of chromosome 4q. Together these observations implicate PDGFRA and KIT as potential oncogenes in NSCLC, but further study is needed to define the specific characteristics of those tumors that could respond to PDGFRalpha/KIT inhibitors.

Response to imatinib mesylate depends on the presence of the V559A-mutated KIT oncogene.

The Wnt/beta-catenin pathway plays an important role in initiation in most, if not all, colon cancers. Prior work has provided important insights into the regulation of beta-catenin stability in the cytoplasm; however, relatively little is known about the mechanism by which beta-catenin activates gene transcription in the nucleus. Using genetic approaches, studies in human colon cancers and Drosophila have identified CDK8 as a colon cancer oncogene that regulates beta-catenin transcriptional activity. These convergent observations provide new insights into the regulation of nuclear beta-catenin activity and identify a novel therapeutic target for beta-catenin-driven malignancies.

Expression of activated STAT5 in neoplastic mast cells in systemic mastocytosis: subcellular distribution and role of the transforming oncoprotein KIT D816V.

Recent data suggest that the signal transducer and activator of transcription (STAT)5 contributes to differentiation and growth of mast cells. It has also been described that constitutively phosphorylated STAT5 (pSTAT5) plays a pro-oncogenic role in various myeloid neoplasms. We examined the expression of pSTAT5 in neoplastic mast cells in systemic mastocytosis and asked whether the disease-related oncoprotein KIT D816V is involved in STAT5 activation. As assessed by immunohistochemistry using the anti-pSTAT5 antibody AX1, neoplastic mast cells were found to display pSTAT5 in ALL SM patients examined (n = 40). expression of pSTAT5 was also demonstrable in the KIT D816V-positive mast cell leukemia cell line HMC-1. Using various staining-protocols, pSTAT5 was found to be located in both the cytoplasmic and nuclear compartment of mast cells. To define the functional role of KIT D816V in STAT5-activation, Ba/F3 cells with doxycycline-inducible expression of KIT D816V were used. In these cells, induction of KIT D816V resulted in an increased expression of pSTAT5 without substantial increase in total STAT5. Moreover, the KIT D816V-targeting kinase-inhibitor PKC412 was found to counteract expression of pSTAT5 in HMC-1 cells as well as doxycycline-induced expression of pSTAT5 in Ba/F3 cells. Finally, a dominant negative STAT5-construct was found to inhibit growth of HMC-1 cells. Together, our data show that neoplastic mast cells express cytoplasmic and nuclear pSTAT5, that KIT D816V promotes STAT5-activation, and that STAT5-activation contributes to growth of neoplastic mast cells.

A Variant in a MicroRNA complementary site in the 3 UTR of the KIT oncogene increases risk of acral melanoma.

MicroRNAs (miRNAs) are small approximately 22nt single stranded RNAs that negatively regulate protein expression by binding to partially complementary sequences in the 3 untranslated region (3 UTRs) of target gene messenger RNAs (mRNA). Recently, mutations have been identified in both miRNAs and target genes that disrupt regulatory relationships, contribute to oncogenesis and serve as biomarkers for cancer risk. KIT, an established oncogene with a multifaceted role in melanogenesis and melanoma pathogenesis, has recently been shown to be upregulated in some melanomas, and is also a target of the miRNA miR-221. Here, we describe a genetic variant in the 3 UTR of the KIT oncogene that correlates with a greater than fourfold increased risk of acral melanoma. This KIT variant results in a mismatch in the seed region of a miR-221 complementary site and reporter data suggests that this mismatch can result in increased expression of the KIT oncogene. Consistent with the hypothesis that this is a functional variant, KIT mRNA and protein levels are both increased in the majority of samples harboring the KIT variant. This work identifies a novel genetic marker for increased heritable risk of melanoma.

Clonal analysis of NRAS activating mutations in KIT-D816V systemic mastocytosis.

Cooperating genetic events are likely to contribute to the phenotypic diversity of KIT-D816V systemic mastocytosis. In this study, 44 patients with KIT-D816V systemic mastocytosis were evaluated for coexisting NRAS, KRAS, HRAS or MRAS mutations. Activating NRAS mutations were identified in 2 of 8 patients with advanced disease. NRAS mutations were not found in patients with indolent systemic mastocytosis. To better understand the clonal evolution of mastocytosis, we evaluated the cell compartments impacted by the NRAS and KIT mutations. Clonal mast cells harbored both mutations. KIT-D816V was not detected in bone marrow CD34(+) progenitors, whereas the NRAS mutation was present. These findings suggest that NRAS mutations may have the potential to precede KIT-D816V in clonal development. Unlike other mature lineages, mast cell survival is dependent on KIT and the presence of these two activating mutations may have a greater impact on the expansion of this cell compartment and in resultant disease severity.

Mechanisms of STAT protein activation by oncogenic KIT mutants in neoplastic mast cells.

mutations in the c-kit gene occur in the vast majority of mastocytosis. In adult patients as well as in the cell line derived from mast cell neoplasms, the mutations occur almost exclusively at amino acid 816 within the kinase domain of KIT. Among the downstream effectors of KIT signaling, STAT3 and STAT5 have been shown to be critical for cell proliferation elicited by the KIT-Asp(816) mutant protein. However, little is known about the mechanisms of activation of STAT proteins. In this study, we identify and clarify the contribution of various STAT kinases in two widely used neoplastic mast cell lines, P815 and HMC-1. We show that STAT1, -3, and -5 proteins are activated downstream of the KIT-Asp(816) mutant. ALL three STAT proteins are located in the nucleus and are phosphorylated on serine residues. KIT-Asp(816) mutant can directly phosphorylate STATs on the activation-specific tyrosine residues in vitro. However, within cells, SRC family kinases and JAKs diversely contribute to tyrosine phosphorylation of STAT proteins downstream of the KIT mutant. Using a panel of inhibitors, we provide evidence for the implication or exclusion of serine/threonine kinases as responsible for serine phosphorylation of STAT1, -3, and -5 in the two cell lines. Finally, we show that only STAT5 is transcriptionally active in these cells. This suggests that the contribution of STAT1 and STAT3 downstream of KIT mutant is independent of their transcription factor function.

KIT-D816V-independent oncogenic signaling in neoplastic cells in systemic mastocytosis: role of Lyn and Btk activation and disruption by dasatinib and bosutinib.

Systemic mastocytosis (SM) either presents as a malignant neoplasm with short survival or as an indolent disease with normal life expectancy. In both instances, neoplastic mast cells (MCs) harbor D816V-mutated KIT, suggesting that additional oncogenic mechanisms are involved in malignant transformation. We here describe that Lyn and Btk are phosphorylated in a KIT-independent manner in neoplastic MCs in advanced SM and in the MC leukemia cell line HMC-1. Lyn and Btk activation was not only detected in KIT D816V-positive HMC-1.2 cells, but also in the KIT D816V-negative HMC-1.1 subclone. Moreover, KIT D816V did not induce Lyn/Btk activation in Ba/F3 cells, and deactivation of KIT D816V by midostaurin did not alter Lyn/Btk activation. siRNAs against Btk and Lyn were found to block survival in neoplastic MCs and to cooperate with midostaurin in producing growth inhibition. Growth inhibitory effects were also obtained with 2 targeted drugs, dasatinib which blocks KIT, Lyn, and Btk activation in MCs, and bosutinib, a drug that deactivates Lyn and Btk without blocking KIT activity. Together, KIT-independent signaling via Lyn/Btk contributes to growth of neoplastic MCs in advanced SM. Dasatinib and bosutinib disrupt Lyn/Btk-driven oncogenic signaling in neoplastic MC, which may have clinical implications and explain synergistic drug interactions.

Rho kinase regulates the survival and transformation of cells bearing oncogenic forms of KIT, FLT3, and BCR-ABL.

We show constitutive activation of Rho kinase (ROCK) in cells bearing oncogenic forms of KIT, FLT3, and BCR-ABL, which is dependent on PI3K and Rho GTPase. Genetic or pharmacologic inhibition of ROCK in oncogene-bearing cells impaired their growth as well as the growth of acute myeloid leukemia patient-derived blasts and prolonged the life span of mice bearing myeloproliferative disease. Downstream from ROCK, rapid dephosphorylation or loss of expression of myosin light chain resulted in enhanced apoptosis, reduced growth, and loss of actin polymerization in oncogene-bearing cells leading to significantly prolonged life span of leukemic mice. In summary we describe a pathway involving PI3K/Rho/ROCK/MLC that may contribute to myeloproliferative disease and/or acute myeloid leukemia in humans.

[Modulation of activated oncogene c-kit expression with RNA-interference].

Hyperexpression of oncogene c-kit is found in 80% patients with acute myeloid leukemia (AML). The transgenic model cell line expressing the oncogene c-kit was obtained by transduction with recombinant retrovirus. We have designed small interfering RNAs (siRNA) efficiently suppressing the expression of activated oncogene c-kit. Further small hairpin RNAs (shRNA) targeting c-kit mRNA were designed and expressed in lentiviral vectors. We report a stable reduction in c-kit expression following the introduction of shRNAs into model cells as well as Kasumi-1 cells from the patient with AML.

Expression of proto-oncogene KIT is up-regulated in subset of human meningiomas.

BACKGROUND: KIT is a proto-oncogene involved in diverse neoplastic processes. Aberrant kinase activity of the KIT receptor has been targeted by tyrosine kinase inhibitor (TKI) therapy in different neoplasias. In ALL the earlier studies, KIT expression was reported to be absent in meningiomas. However, we observed KIT mRNA expression in some meningioma cases. This prompted us to undertake its detailed analyses in meningioma tissues resected during 2008-2009. METHODS: tumor tissues and matched peripheral blood samples collected from meningioma patients were used for detailed molecular analyses. KIT expression was ascertained immunohistochemically and validated by immunoblotting. KIT and KITLG transcript levels were discerned by reverse transcription quantitative real-time PCR (RT-qPCR). Similarly, KIT amplification and allele loss were assessed by quantitative real-time (qPCR) and validated by fluorescence in situ hybridization (FISH) on the neoplastic tissues. Possible alterations of the gene at the nucleotide level were analyzed by sequencing. RESULTS: Contrary to earlier reports, KIT expression, was detected immunohistochemically in 20.6% meningioma cases (n = 34). Receptor (KIT) and ligand (KITLG) transcripts monitored by RT-qPCR were found to co-express (p = 0.048) in most of the KIT immunopositive tumors. 1/7 KIT positive meningiomas showed allele loss corroborated by reduced FISH signal in the corresponding neoplastic tissue. Sequence analysis of KIT showed M541L substitution in exon 10, in one of the immunopositive cases. However, its biological consequence remains to be uncovered. CONCLUSIONS: This study clearly demonstrates KIT over-expression in the human meningiomas. The data suggest that up-regulated KIT transcription (p < 0.001), instead of gene amplification (p > 0.05), is a likely mechanism responsible for altered KIT expression. Thus, KIT is a potential candidate for detailed investigation in the context of meningioma pathogenesis.

Hyperpigmentation of the hard palate associated with imatinib therapy for chronic myeloid leukemia with a genetic variation in the proto-oncogene c-KIT.

The HRAS gene encodes a protein with a molecular weight of 21 kDa (P21) called H-Ras that is involved primarily in regulating cell growth, division and apoptosis. Through a process known as signal transduction, the H-Ras protein relays signals from outside of the cell to the cell s nucleus. These signals instruct the cell to grow or divide. HRAS is in the Ras family of oncogenes. When mutated, oncogenes have the potential to cause normal cells to become cancerous cells. Considering the upsurge of evidences that abnormality in CpG methylation of the oncogene promoter region can cause cancer, we want to understand the relationships between the methylation status of the HRAS promoter region and bladder cancer. To investigate the methylation pattern of HRAS gene transcriptional regulation region (TRR), bisulfite-sequencing PCR-based sequencing analysis was performed among 15 bladder cancer tissues and 5 normal bladder tissues. Analysis of HRAS gene TRR methylation showed that the methylation level of HRAS has clinical relevance (P = 0.0049, by unpaired Student s t test) with bladder cancer. Furthermore, the unpaired Student s t test analysis showed the extremely significant relationship between tumor and normal at CpG site of the 3rd (P < 0.0001), 28th (P = 0.0006), and significant association between tumor and methylation at CpG site of the 12th (P = 0.0024). Abnormal methylation of the HRAS gene may be an early event during urocystic tumorigenesis and may be further used as a cancer biomarker in bladder tissue for early diagnosis and a potential therapeutic target.

KIT proto-oncogene exon 8 deletions at codon 419 are highly frequent in acute myeloid leukaemia with inv(16) in Indian population.

The KIT gene is a receptor tyrosine kinase class III expressed by early hematopoietic progenitor cells and plays a significant role in hematopoietic stem cell proliferation, differentiation and survival which is considered to be a remarkable feature in the course of growth of acute myeloid leukaemia (AML). Owing to insufficient study of mutations in the KIT gene, the diagnosis and rate of recurrence of these mutations with divergent subtypes in AML cases in India is of concern. In order to find out the frequency of mutations of KIT gene exon 8 in 109 AML cases, we have performed polymerase chain reaction-single-strand conformation polymorphism (PCR-SSCP) followed by DNA sequencing and have identified 24 mutations in exon 8 in 13 cases, including deletions at codon 418 (n = 3), 419 (n = 11) and 420 (n = 5) as well as point mutations at codon 417 (n = 1) and 421 (n = 4). In eleven AML cases, exon 8 deletion and point mutations involved the loss at codon Asp419 immoderately conserved cross species placed in the receptor extracellular domain. Frequency elevation of the KIT proto-oncogene exon 8 deletion and point mutations in AML cases allude a crucial function for this region of the receptor extracellular domain. Thus, we report the incidence of acquired mutations in exon 8, with consistent loss at codon Asp419, in 10.09 % of AML cases in a selected Indian population.

Downregulation of Fas activity rescues early onset of diabetes in c-Kit(Wv/+) mice.

c-Kit and its ligand stem cell factor (SCF) are important for beta-cell survival and maturation; meanwhile, interactions between the Fas receptor (Fas) and Fas ligand are capable of triggering beta-cell apoptosis. Disruption of c-Kit signaling leads to severe loss of beta-cell mass and function with upregulation of Fas expression in c-Kit(Wv/+) mouse islets, suggesting that there is a critical balance between c-Kit and Fas activation in beta-cells. In the present study, we investigated the interrelationship between c-Kit and Fas activation that mediates beta-cell survival and function. We generated double mutant, c-Kit(Wv/+);Fas(lpr/lpr) (Wv(-/-)), mice to study the physiological and functional role of Fas with respect to beta-cell function in c-Kit(Wv/+) mice. Isolated islets from these mice and the INS-1 cell line were used. We observed that islets in c-Kit(Wv/+) mice showed a significant increase in beta-cell apoptosis along with upregulated p53 and Fas expression. These results were verified in vitro in INS-1 cells treated with SCF or c-Kit siRNA combined with a p53 inhibitor and Fas siRNA. In vivo, Wv(-/-) mice displayed improved beta-cell function, with significantly enhanced insulin secretion and increased beta-cell mass and proliferation compared with Wv(+/+) mice. This improvement was associated with downregulation of the Fas-mediated caspase-dependent apoptotic pathway and upregulation of the cFlip/NF-kappaB pathway. These findings demonstrate that a balance between the c-Kit and Fas signaling pathways is critical in the regulation of beta-cell survival and function.

The G-quadruplex ligand, SYUIQ-FM05, targets proto-oncogene c-kit transcription and induces apoptosis in K562 cells.

CONTEXT: N -(7-Fluoro-5-N-methyl-10H-indolo[3,2-b]quinolin-5-ium)-N,N-dimethylpropane-1,3- diamine iodide (SYUIQ-FM05) is a semi-synthetic derivative of cryptolepine which is from Cryptolepis sanguinolenta (Lindl.) Schlechter (Periplocaeae). This ligand inhibits telomerase activity by stabilizing the G-quadruplex structure and induces growth arrest in cancer cells. OBJECTIVE: The anticancer activity of SYUIQ-FM05 via inhibiting c-kit transcription was investigated in leukemic cells. MATERIALS AND METHODS: The cytotoxicity of SYUIQ-FM05 in K562 cells was evaluated using a cell viability assay and flow cytometry (FCM) at 0.4, 2.0, 10.0 and 20.0 nM. Under the same concentrations of SYUIQ-FM05 or 100 nM imatinib mesylate (IM), quantitative polymerase chain reaction (Q-PCR) investigated transcription of c-kit and bcl-2, and western blotting analyzed the expression levels of c-Kit, total mitogen-activated protein kinase kinases (MEKs), phospho-MEK (p-MEK), total extracellular regulated protein kinases (ERKs), phospho-ERK (p-ERK), Bcl-2 and Bax. RESULTS: SYUIQ-FM05 inhibited cellular growth with an IC(50) of 10.83 +/- 0.05 nM in K562 cells. c-Kit transcription was suppressed 2.69-, 4.39-, 7.71- and 10.52-fold at 0.4, 2.0, 10.0 and 20.0 nM SYUIQ-FM05, respectively, which produced proportional loss of total c-Kit protein except IM. Both SYUIQ-FM05 and IM downregulated p-MEK and p-ERK. Furthermore, bcl-2 transcription was suppressed 1.58- and 1.86-fold at 10.0 and 20.0 nM SYUIQ-FM05, respectively, but 0.4 and 2.0 nM SYUIQ-FM05 had no effect. A decrease in Bcl-2 and an increase in Bax appeared in these treated cells. DISCUSSION AND CONCLUSION: These findings demonstrate that SYUIQ-FM05 could induce apoptosis in a leukemic cell line through inhibiting c-kit transcription, which supports the anticancer potency of SYUIQ-FM05 in c-Kit-positive leukemic cells.

[C-kit and other receptor tyrosine kinases play a crucial role in oncogenic signaling and drug-resistance].

BACKGROUND: The Src family tyrosine kinases (SFK) are cellular regulatory proteins that influence cell adhesion, proliferation, invasion and survival during tumor development. Elevated activity of Src was associated with increased cell proliferation and invasivity in human papillomavirus (HPV)-associated malignancies; therefore, transduced human foreskin keratinocytes (HFK) were used to investigate whether SFK activation is a downstream effect of papillomaviral oncoproteins. Activation of ubiquitously expressed SFKs, namely Src, Yes and Fyn, was investigated in both proliferating and differentiating keratinocytes. RESULTS: In proliferating keratinocytes, Src, Yes and Fyn mRNA levels were not affected by HPV 16 E6 or E7 oncoproteins, while at the protein level as detected by western blot, the presence of both E6 and E7 resulted in substantial increase in Src and Yes expression, but did not alter the high constitutive level of Fyn. Phospo-kinase array revealed that ALL ubiquitously expressed SFKs are activated by phosphorylation in the presence of HPV 16 E7 oncoprotein. Keratinocyte differentiation led to increased Yes mRNA and protein levels in ALL transduced cell lines, while it did not influence the Src transcription but resulted in elevated Src protein level in HPV16 E7 expressing lines. CONCLUSIONS: This study revealed that HPV 16 oncoproteins upregulate Src family kinases Src and Yes via posttranscriptional mechanisms. A further effect of HPV 16 E7 oncoprotein is to enhance the activating phosphorylation of SFKs expressed in keratinocytes.

Identification of the c-kit gene mutations in biopsy tissues of mammary gland carcinoma tumor.

C-kit gene is a transmembrane tyrosine kinase that acts as type III receptor for mast cell growth factor and cellular migration, proliferation, survival of melanoblasts, haematopoietic progenitors and primordial germ cells. Apart from the scant information about the pathologies associated with loss-of-function mutations, few reports have proposed role of the c-kit gene in case of carcinogenesis. Apparently, in breast cancer the involvement of c-kit gene mutations has been considered as a rare phenomenon. Thus, we designed our study with aim to investigate the c-kit gene mutation in breast cancer, and their correlation with clinico-pathological findings. We performed mutational analysis of the c-kit gene in 58 cases of malignant breast cancer. With the aim to ascertain the variety of mutations at exon 8, 9, 11, 13, 15 and 17 of c-kit gene in breast cancer, we have done PCR-SSCP followed by DNA sequencing. In breast cancer the c-kit gene mutation rates were 3.44% (02/58) in exon 8, 5.17% (3/58) in exon 9, 5.17% (3/58) in exon 11, 3.44% (2/580 in exon 13, 3.44% (2/58) in exon 15 and 5.17% (3/58) in exon 17, respectively. The overall c-kit mutation frequency in exons 8, 9, 11, 13, 15 and 17 was determined to be 25.86% (15/58). Our study indicates to specify the role of c-kit proto-oncogene mutation in breast cancer. The result signifies that c-kit gene plays a poor role in prognosis of ductal and lobular carcinoma.

Src-like-adaptor protein (SLAP) differentially regulates normal and oncogenic c-Kit signaling.

The Src-like-adaptor protein (SLAP) is an adaptor protein sharing considerable structural homology with Src. SLAP is expressed in a variety of cells and regulates receptor tyrosine kinase signaling by direct association. In this report, we show that SLAP associates with both wild-type and oncogenic c-Kit (c-Kit-D816V). The association involves the SLAP SH2 domain and receptor phosphotyrosine residues different from those mediating Src interaction. Association of SLAP triggers c-Kit ubiquitylation which, in turn, is followed by receptor degradation. Although SLAP depletion potentiates c-Kit downstream signaling by stabilizing the receptor, it remains non-functional in c-Kit-D816V signaling. Ligand-stimulated c-Kit or c-Kit-D816V did not alter membrane localization of SLAP. Interestingly oncogenic c-Kit-D816V, but not wild-type c-Kit, phosphorylates SLAP on residues Y120, Y258 and Y273. Physical interaction between c-Kit-D816V and SLAP is mandatory for the phosphorylation to take place. Although tyrosine-phosphorylated SLAP does not affect c-Kit-D816V signaling, mutation of these tyrosine sites to phenylalanine can restore SLAP activity. Taken together the data demonstrate that SLAP negatively regulates wild-type c-Kit signaling, but not its oncogenic counterpart, indicating a possible mechanism by which the oncogenic c-Kit bypasses the normal cellular negative feedback control.

KIT oncogene inhibition drives intratumoral macrophage M2 polarization.

tumor-associated macrophages (TAMs) are a major component of the cancer microenvironment. Modulation of TAMs is under intense investigation because they are thought to be nearly always of the M2 subtype, which supports tumor growth. Gastrointestinal stromal tumor (GIST) is the most common human sarcoma and typically results from an activating mutation in the KIT oncogene. Using a spontaneous mouse model of GIST and 57 freshly procured human GISTs, we discovered that TAMs displayed an M1-like phenotype and function at baseline. In both mice and humans, the KIT oncoprotein inhibitor imatinib polarized TAMs to become M2-like, a process which involved TAM interaction with apoptotic tumor cells leading to the induction of CCAAT/enhancer binding protein (C/EBP) transcription factors. In human GISTs that eventually developed resistance to imatinib, TAMs reverted to an M1-like phenotype and had a similar gene expression profile as TAMs from untreated human GISTs. Therefore, TAM polarization depends on tumor cell oncogene activity and has important implications for immunotherapeutic strategies in human cancers.

Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand.

Structural features of v-kit, the oncogene of HZ4 feline sarcoma virus, suggested that this gene arose by transduction and truncation of cellular sequences. Complementary DNA cloning of the human proto-oncogene coding for a receptor tyrosine kinase confirmed this possibility: c-kit encodes a transmembrane glycoprotein that is structurally related to the receptor for macrophage growth factor (CSF-1) and the receptor for platelet-derived growth factor. The c-kit gene is widely expressed as a single, 5-kb transcript, and it is localized to human chromosome 4 and to mouse chromosome 5. A c-kit peptide antibody permitted the identification of a 145,000 dalton c-kit gene product that is inserted in the cellular plasma membrane and is capable of self-phosphorylation on tyrosine residues in both human glioblastoma cells and transfected mouse fibroblasts. Our results suggest that p145c-kit functions as a cell surface receptor for an as yet unidentified ligand. Furthermore, carboxy- and amino-terminal truncations that occurred during the viral transduction process are likely to have generated the transformation potential of v-kit.

Primary structure of c-kit: relationship with the CSF-1/PDGF receptor kinase family--oncogenic activation of v-kit involves deletion of extracellular domain and C terminus.

The protein kinase domains of v-kit, the oncogene of the acute transforming feline retrovirus HZ4-FeSV (HZ4-feline sarcoma virus), CSF-1R (macrophage colony stimulating factor receptor) and PDGFR (platelet derived growth factor receptor) display extensive homology. Because of the close structural relationship of v-kit, CSF-1R and PDGFR we predicted that c-kit would encode a protein kinase transmembrane receptor (Besmer et al., 1986a; Yarden et al., 1986). We have now determined the primary structure of murine c-kit from a DNA clone isolated from a brain cDNA library. The nucleotide sequence of the c-kit cDNA predicts a 975 amino acid protein product with a calculated mol. wt of 109.001 kd. It contains an N-terminal signal peptide, a transmembrane domain (residues 519-543) and in the C-terminal half the v-kit homologous sequences (residues 558-925). c-kit therefore contains the features which are characteristic of a transmembrane receptor kinase. Comparison of c-kit, CSF-1R and PDGFR revealed a unique structural relationship of these receptor kinases suggesting a common evolutionary origin. The outer cellular domain of c-kit was shown to be related to the immunoglobulin superfamily. The sites of expression of c-kit in normal tissue predict a function in the brain and in hematopoietic cells. N-terminal sequences which include the extracellular domain and the transmembrane domain as well as 50 amino acids from the C-terminus of c-kit are deleted in v-kit. These structural alterations are likely determinants of the oncogenic activation of v-kit.(ABSTRACT TRUNCATED AT 250 WORDS)FAU - Qiu, F H

The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus.

Mice carrying mutations at the W locus located on chromosome 5 are characterized by severe macrocytic anaemia, lack of hair pigmentation and sterility. mutations at this locus appear to affect the proliferation and/or migration of cells during early embryogenesis and result in an intrinsic defect in the haematopoietic stem cell hierarchy. An understanding of the molecular basis of the complex and pleiotropic phenotype in W mutant mice would thus provide insights into the important developmental processes of gametogenesis, melanogenesis and haematopoiesis. Here we show that the mouse mutant W has a deletion of the c-kit proto-oncogene. Interspecific backcross analysis demonstrates that the W locus is very tightly linked to c-kit and that the two loci cannot be segregated at this level of analysis. c-kit is the cellular homologue of the oncogene v-kit of the HZ4 feline sarcoma virus and encodes a transmembrane protein tyrosine kinase receptor that is structurally similar to the receptors for colony-stimulating factor-1 (CSF-1) and platelet derived growth factor. The co-localization of c-kit with W provides a molecular entry into this important region of the mouse genome. In addition, these observations provide the first example of a germ-line mutation in a mammalian proto-oncogene and implicate the c-kit gene as a candidate for the W locus.

The dominant-white spotting (W) locus of the mouse encodes the c-kit proto-oncogene.

mutations at the W locus in the mouse have pleiotropic effects on embryonic development and hematopoiesis. The characteristic phenotype of mutants at this locus, which includes white coat color, sterility, and anemia, can be attributed to the failure of stem cell populations to migrate and/or proliferate effectively during development. Mapping experiments suggest that the c-kit proto-oncogene, which encodes a putative tyrosine kinase receptor, is a candidate for the W locus. We show here that the c-kit gene is disrupted in two spontaneous mutant W alleles, W44 and Wx. Genomic DNA that encodes amino acids 240 to 342 of the c-kit polypeptide is disrupted in W44; the region encoding amino acids 342 to 791 is disrupted in Wx. W44 homozygotes exhibit a marked reduction in levels of c-kit mRNA. These results strongly support the identification of c-kit as the gene product of the W locus.

A new human mast cell line expressing a functional IgE receptor converts to tumorigenic growth by KIT D816V transfection.

In systemic mastocytosis (SM), clinical problems arise from factor-independent proliferation of mast cells (MCs) and the increased release of mediators by MCs, but no human cell line model for studying MC activation in the context of SM is available. We have created a stable stem cell factor (SCF) -dependent human MC line, ROSA(KIT WT), expressing a fully functional immunoglobulin E (IgE) receptor. Transfection with KIT D816V converted ROSA(KIT WT) cells into an SCF-independent clone, ROSA(KIT D816V), which produced a mastocytosis-like disease in NSG mice. Although several signaling pathways were activated, ROSA(KIT D816V) did not exhibit an increased, but did exhibit a decreased responsiveness to IgE-dependent stimuli. Moreover, NSG mice bearing ROSA(KIT D816V)-derived tumors did not show mediator-related symptoms, and KIT D816V-positive MCs obtained from patients with SM did not show increased IgE-dependent histamine release or CD63 upregulation. Our data show that KIT D816V is a disease-propagating oncoprotein, but it does not activate MCs to release proinflammatory mediators, which may explain why mediator-related symptoms in SM occur preferentially in the context of a coexisting allergy. ROSA(KIT D816V) may provide a valuable tool for studying the pathogenesis of mastocytosis and should facilitate the development of novel drugs for treating SM patients.

The expression of the proto-oncogene C-kit in the blast cells of acute myeloblastic leukemia.

The oncogene kit has been shown genetically to map in the W locus of the mouse. This locus is known to have an important role in the regulation of normal hemopoietic stem cell growth. The blast cells of acute myeloblastic leukemia may be considered to arise in predeterministic stem cells. Accordingly, we sought evidence that kit was involved in the regulation of AML blast growth, using a cDNA probe to the external domain of c-kit. With this probe the gene was found to be in germline configuration in blast cells from AML, ALL, and continuous myeloblastic cell lines. However, expression could be detected by Northern analysis or RNA dot blots only in fresh AML blast cells. Fresh cells from ALL patients, normal bone marrow, PHA-stimulated lymphocytes, and four myeloblastic continuous cell lines were expression negative by the same techniques.

Sequencing and G-quadruplex folding of the canine proto-oncogene KIT promoter region: might dog be used as a model for human disease?.

Downregulation of gene expression by induction of non-canonical DNA structures at promotorial level is a novel attractive anticancer strategy. In human, two guanine-rich sequences (h_kit1 and h_kit2) were identified in the promotorial region of oncogene KIT. Their stabilization into G-quadruplex structures can find applications in the treatment of leukemias, mastocytosis, gastrointestinal stromal tumor, and lung carcinomas which are often associated to c-kit mis-regulation. Also the most common skin cancer in domestic dog, mast cell tumor, is linked to a mutation and/or to an over-expression of c-kit, thus supporting dog as an excellent animal model. In order to assess if the G-quadruplex mediated mechanism of regulation of c-kit expression is conserved among the two species, herein we cloned and sequenced the canine KIT promoter region and we compared it with the human one in terms of sequence and conformational equilibria in physiologically relevant conditions. Our results evidenced a general conserved promotorial sequence between the two species. As experimentally confirmed, this grants that the conformational features of the canine kit1 sequence are substantially shared with the human one. Conversely, two isoforms of the kit2 sequences were identified in the analyzed dog population. In comparison with the human counterpart, both of them showed an altered distribution among several folded conformations.

The overexpression of KIT proto-oncogene in acute leukemic cells is not necessarily caused by the gene mutation.

KIT is detected in a variety of cells, also in acute leukemia. Inhibition of wild-type KIT is not always satisfactory. The aim of this work was to evaluate the frequency of the most common KIT mutations in acute myeloid leukemia (AML) and determine the correlation between mutation and expression level. Samples were obtained from 75 patients with AL. CD117 presence was shown in 45 of 51 patients with AML and in 1 of 16 patients with acute lymphocytic leukemia (ALL). Asp816Val mutation was found in 3.5% of cases of AML and Val560Gly mutation in 1 sample with acute biclonal leukemia. Other genetic changes were found in 15 of 57 samples with AML: polymorphisms Met541Leu in 14% of cases, Lys546Lys in 7% and 1 case of acute biclonal leukemia, Ile798Ile in 5.3% of cases, Met541Leu in 1 acute biphenotypic leukemia and in 6.3% of ALL. Polymorphism Lys546Lys was also shown in 1 case of acute biclonal leukemia. Nonsilent genetic changes were detected in a total of 23% cases with core binding factor leukemia. There was no statistical significance between KIT expression and genetic changes. There was no correlation between the incidence and types of KIT mutations and its expression on cells in AML.

The activation loop tyrosine 823 is essential for the transforming capacity of the c-Kit oncogenic mutant D816V.

Oncogenic c-Kit mutations have been shown to display ligand-independent receptor activation and cell proliferation. A substitution of aspartate to valine at amino acid 816 (D816V) is one of the most commonly found oncogenic c-Kit mutations and is found in >90% of cases of mastocytosis and less commonly in germ-cell tumors, core-binding factor acute myeloid leukemia and mucosal melanomas. The mechanisms by which this mutation leads to constitutive activation and transformation are not fully understood. Previous studies have shown that the D816V mutation causes a structural change in the activation loop (A-loop), resulting in weaker binding of the A-loop to the juxtamembrane domain. In this paper, we have investigated the role of Y823, the only tyrosine residue in the A-loop, and its role in oncogenic transformation by c-Kit/D816V by introducing the Y823F mutation. Although dispensable for the kinase activity of c-Kit/D816V, the presence of Y823 was crucial for cell proliferation and survival. Furthermore, mutation of Y823 selectively downregulates the Ras/Erk and Akt pathways as well as the phosphorylation of STAT5 and reduces the transforming capacity of the D816V/c-Kit in vitro. We further show that mice injected with cells expressing c-Kit/D816V/Y823F display significantly reduced tumor size as well as tumor weight compared with controls. Finally, microarray analysis, comparing Y823F/D816V cells with cells expressing c-Kit/D816V, demonstrate that mutation of Y823 causes upregulation of proapoptotic genes, whereas genes of survival pathways are downregulated. Thus, phosphorylation of Y823 is not necessary for kinase activation, but essential for the transforming ability of the c-Kit/D816V mutant.

Unusual c-KIT+ squamous cell carcinoma of the uterine cervix showing paradoxical hypermethylation of the c-KIT proto-oncogene.

expression of the oncogene hepatocyte growth factor receptor (MET) and phosphorylation of the MET protein have been associated with both primary and acquired resistance to tyrosine kinase inhibitors (TKIs) used in therapy targeting the epidermal growth factor receptor (EGFR) in patients with non-small cell lung cancers (NSCLCs). Therefore, simultaneous inhibition of both of these receptor tyrosine kinases (RTKs) should improve disease treatment. Our previous study of microRNA (miRNA) expression signatures of lung squamous cell carcinoma (lung-SCC) revealed that microRNA-206 (miR206) was significantly reduced in lung-SCC tissues, suggesting that miR206 functions as a tumor suppressor in the disease. Furthermore, putative miR206 binding sites were annotated in the 3 -UTRs of MET and EGFR RTKs in miRNA databases. The aim of the study was to investigate the functional significance of miR206 in lung-SCC and to confirm the inhibition of both MET and EGFR oncogenic signaling by expression of miR206 in cancer cells. We found that restoration of mature miR206 inhibited cancer cell proliferation, migration, and invasion in EBC-1 cells through downregulation of both mRNA and protein levels of MET and EGFR. Interestingly, phosphorylation of ERK1/2 and AKT signaling were inhibited by restoration of miR206 in cancer cells. Overexpression of MET and EGFR were observed in clinical specimens of lung-SCC. tumor-suppressive miR206 inhibited dual signaling networks activated by MET and EGFR, and these findings will provide new insights into the novel molecular mechanisms of lung-SCC oncogenesis and new therapeutic approaches for the treatment of this disease.

Human PDGFA receptor gene maps to the same region on chromosome 4 as the KIT oncogene.

The gene for the human platelet-derived growth factor (PDGF) A type receptor was assigned to the proximal long arm of chromosome 4 by using in situ hybridization. Of 141 labeled metaphase cells, 74 had grains over chromosome 4, with a distinct peak at bands q11-q12. The presence of the gene on chromosome 4 was also confirmed by hybridization to chromosome specific libraries. This places the PDGFA receptor gene in the same region of chromosome 4 as the KIT oncogene, another member of the PDGF growth factor receptor subfamily. The two other members of this gene family, the PDGFB receptor and the colony stimulating factor-1 (CSF1) receptor, are closely linked on the distal half of the long arm of chromosome 5.

PI3 kinase is indispensable for oncogenic transformation by the V560D mutant of c-Kit in a kinase-independent manner.

Oncogenic mutants of c-Kit are often found in mastocytosis, gastrointestinal stromal tumors and acute myeloid leukemia. The activation mechanism of the most commonly occurring mutation, D816V in exon 17 of c-Kit, has been well-studied while other mutations remain fairly uncharacterized in this respect. In this study, we show that the constitutive activity of the exon 11 mutant V560D is weaker than the D816V mutant. Phosphorylation of downstream signaling proteins induced by the ligand for c-Kit, stem cell factor, was stronger in c-Kit/V560D expressing cells than in cells expressing c-kit/D816V. Although cells expressing c-Kit/V560D showed increased ligand-independent proliferation and survival compared to wild-type c-Kit-expressing cells, these biological effects were weaker than in c-Kit/D816V-expressing cells. In contrast to cells expressing wild-type c-Kit, cells expressing c-Kit/V560D were independent of Src family kinases for downstream signaling. However, the independence of Src family kinases was not due to a Src-like kinase activity that c-Kit/D816V displayed. Point mutations that selectively block the association of PI3 kinase with c-Kit/V560D inhibited ligand-independent activation of the receptor, while inhibition of the kinase activity of PI3 kinase with pharmacological inhibitors did not affect the kinase activity of the receptor. This suggests a lipid kinase-independent key role of PI3 kinase in c-Kit/V560D-mediated oncogenic signal transduction. Thus, PI3 kinase is an attractive therapeutic target in malignancies induced by c-Kit mutations independent of its lipid kinase activity.

Neutralization of KIT Oncogenic Signaling in Leukemia with Antibodies Targeting KIT Membrane Proximal Domain 5.

KIT is a cell surface tyrosine kinase receptor whose ligand stem cell factor (SCF) triggers homodimerization and activation of downstream effector pathways involved in cell survival, proliferation, homing, or differentiation. KIT-activating mutations are major oncogenic drivers in subsets of acute myeloid leukemia (AML), in mast cell leukemia, and in gastrointestinal stromal tumors (GIST). The overexpression of SCF and/or wild-type (WT) KIT is also observed in a number of cancers, including 50% of AML and small cell lung cancer. The use of tyrosine kinase inhibitors (TKI) in these pathologies is, however, hampered by initial or acquired resistance following treatment. Using antibody phage display, we obtained two antibodies (2D1 and 3G1) specific for the most membrane proximal extracellular immunoglobulin domain (D5) of KIT, which is implicated in KIT homodimerization. Produced as single chain variable antibody fragments fused to the Fc fragment of a human IgG1, bivalent 2D1-Fc and 3G1-Fc inhibited KIT-dependent growth of leukemic cell lines expressing WT KIT (UT7/Epo) or constitutively active KIT mutants, including the TKI imatinib-resistant KIT D816V mutant (HMC1.2 cell line). In ALL models, either expressing WT KIT or mutated KIT, 2D1 and 3G1-Fc induced KIT internalization and sustained surface downregulation. However, interestingly, KIT degradation was only observed in leukemic cell lines with oncogenic KIT, a property likely to limit the toxicity of these antibodies in patients. These fully human antibody formats may represent therapeutic tools to target KIT signaling in leukemia or GIST, and to bypass TKI resistance of certain KIT mutants.

Retinoic acid triggers c-kit gene expression in spermatogonial stem cells through an enhanceosome constituted between transcription factor binding sites for retinoic acid response element (RARE), spleen focus forming virus proviral integration oncogene (SPFI1) (PU.1) and E26 transformation-specific (ETS).

Restricted availability of retinoic acid (RA) in the testicular milieu regulates transcriptional activity of c-kit (KIT, CD117), which aids in the determination of spermatogonial stem-cell differentiation. The effect of RA on c-kit has been reported previously, but its mode of genomic action remains unresolved. We studied the molecular machinery guiding RA responsiveness to the c-kit gene using spermatogonial stem-cell line C18-4 and primary spermatogonial cells. A novel retinoic acid response element (RARE) positioned at -989 nucleotides upstream of the transcription start site (TSS) was identified, providing a binding site for a dimeric RA receptor (i.e. retinoic acid receptor gamma (RARgamma) and retinoic X receptor). RA treatment influenced c-kit promoter activity, along with endogenous c-kit expression in C18-4 cells. A comprehensive promoter deletion assay using the pGL3B reporter system characterised the region spanning -271 bp and -1011 bp upstream of the TSS, which function as minimal promoter and maximal promoter, respectively. In silico analysis predicted that the region -1011 to +58 bp comprised the distal enhancer RARE and activators such as spleen focus forming virus proviral integration oncogene (SPFI1) (PU.1), specificity protein 1 (SP1) and four E26 transformation-specific (ETS) tandem binding sites at the proximal region. Gel retardation and chromatin immunoprecipitation (ChIP) assays showed binding for RARgamma, PU.1 and SP1 to the predicted consensus binding sequences, whereas GABPalpha occupied only two out of four ETS binding sites within the c-kit promoter region. We propose that for RA response, an enhanceosome is orchestrated through scaffolding of a CREB-binding protein (CBP)/p300 molecule between RARE and elements in the proximal promoter region, controlling germ-line expression of the c-kit gene. This study outlines the fundamental role played by RARgamma, along with other non-RAR transcription factors (PU.1, SP1 and GABPalpha), in the regulation of c-kit expression in spermatogonial stem cells in response to RA.

A HindIII RFLP demonstrated for the kit oncogene on chromosome 4.

By using a combination oligonucleotide probe hybridization and restriction enzyme polymorphism analysis, a series of 48 cases of B-cell chronic lymphocytic leukemia were investigated for activating point mutations at codons 12, 13 and 61 of the K-ras proto-oncogene. A small series of acute leukemias (seven with acute lymphoblastic leukemia (ALL), 11 with acute myeloid leukemia (AML)) were examined in parallel. None of the cases of B-CLL contained detectable activating mutations of the K-ras gene at codon 12 (GGT-gly----GCT-ala) was detected at presentation. In both cases of acute leukemia, the mutation was restricted to one allele and could not be detected in remission samples. Those data suggest that activation of members of the ras oncogene family, typified by K-ras, may be less important in disease pathogenesis in leukemias such as B-CLL that arise from a more committed progenitor.

A new acute transforming feline retrovirus and relationship of its oncogene v-kit with the protein kinase gene family.

A new acute transforming feline retrovirus, the Hardy-Zuckerman 4 feline sarcoma virus (HZ4-FeSV), has been isolated from a feline fibrosarcoma. The viral genome of HZ4-FeSV contains a new oncogene designated v-kit, has the structure 5 delta gag-kit-delta pol-delta env 3 and specifies a gag-kit polyprotein of relative molecular mass 80,000. The predicted kit amino-acid sequence displays partial homology with tyrosine-specific protein kinase oncogenes. HZ4-FeSV appears to have been generated by transduction of feline c-kit sequences with feline leukaemia virus.

Translocated c-myc oncogene of Burkitt lymphoma is transcribed in plasma cells and repressed in lymphoblastoid cells.

We examined somatic cell hybrids between Burkitt lymphoma cells and either human lymphoblastoid cells or mouse plasmacytoma cells for the expression of the translocated c-myc oncogene. The results of this study indicate that the translocated c-myc oncogene is transcribed in plasma cells but is repressed in lymphoblastoid cells. Thus, the factors necessary for translocated c-myc transcription are present in plasma cells and Burkitt lymphoma cells but are absent or inactive in lymphoblastoid cells. Since the distance between the rearranged immunoglobulin loci and the c-myc oncogene can even exceed 30-50 kilobases, we speculate that the translocated c-myc oncogene is under the transcriptional control of enhancer-like elements capable of acting over long distances. The activity of this long-range enhancer may depend on the interaction with transacting factors that are active in plasma cells and in Burkitt lymphoma cells but are not active in lymphoblastoid cells. We also examined the transcription of the first exon of the c-myc oncogene, which becomes separated from the second and third exon because of the chromosomal break involving the first intron. This exon is transcribed at high levels in ST486 Burkitt lymphoma cells with the t(8;14) chromosome translocation. Hybrids between lymphoblastoid and ST486 cells expressed high levels of transcripts of the first exon, whereas hybrids between plasma cells and ST486 cells did not. Thus, transcription of the separated first exon can be enhanced in lymphoblastoid and Burkitt lymphoma cells because of its close proximity to the heavy chain enhancer that is normally located between the joining and the switch region of the C mu gene. Such enhancement, however, does not occur in plasma cells, possibly because these cells are able to suppress completely the c-myc oncogene, unless it has been placed in the proximity of a rearranged immunoglobulin constant region gene.

Immunohistochemical localisation of stem cell factor (SCF) with comparison of its receptor c-Kit proto-oncogene product (c-KIT) in melanocytic tumours.

In order to characterise the distribution and role of stem cell factor (SCF), a recently-reported growth factor for normal melanocytes, we carried out an immunohistochemical study on benign and malignant melanocytic tumours with a comparison with the presence of its receptor c-Kit proto-oncogene product (c-KIT). In normal skin, SCF was mainly observed in endothelial cells of blood vessels but not frequently in basal melanocytes, whereas c-KIT was predominantly localised in tissue mast cells. In benign neoplastic melanocytes (common melanocytic naevi), localisation of SCF and c-KIT was complementary: SCF was mostly found in dermal naevus cells while c-KIT was revealed in epidermal naevus cells, although the expression of the latter antigen was not frequent. Malignant melanoma cells showed less frequent expression of these antigens than those in benign lesions. Of five cultured melanoma cell lines, SCF was observed in only one, and c-KIT was not found in any melanoma cells. No quantitative or qualitative alterations assessed by Western blot analysis were induced in the presence of phenotypic modifiers (sodium butyrate and HMBA). Present data suggest that loss of SCF expression in neoplastic melanocytes is commonly associated with malignant transformation of pigment cells rather than loss of its receptor c-KIT.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) reduces the density of stem cell factor receptors (c-kit oncogene product) on a GM-CSF-dependent human myeloid cell line.

By employing a monoclonal antibody against the stem cell factor receptor (SCF-R), c-kit oncogene product, we analysed in flow cytometric technique the density of SCF-R on GM/SO cells which were incubated under various culture conditions. These experiments revealed that there is an inverse correlation between the SCF-R density on the cells and the doses of granulocyte-macrophage colony-stimulating factor (GM-CSF) in culture medium; the lower the dose, the higher the density of SCF-R on the cells. More detailed analyses showed that, in contrast to SCF which rapidly downregulates its own receptor, GM-CSF does not alter the measurable level of SCF-R in an exposition period of 60 minutes, which suggests that the internalization or shedding of the receptor is not the mechanism of action. Since the most striking difference regarding density of SCF-R between GM-CSF-treated and untreated cells was observed on day 2, the modulation of c-kit oncogene protein by GM-CSF likely occur prior to expression of protein onto the cell surface. In order to exclude the possibility that altered cell viability due to insufficient GM-CSF content in culture medium might be responsible for the increased SCF-R densities on GM-CSF-dependent cells, we subsequently generated a GM-CSF-independent subclone which still responded to GM-CSF as well as the dependent did. The experiments carried out with this subclone confirmed the results presented above. Thus our data suggest that GM-CSF is directly involved in the regulation of SCF receptor density on GM/SO cells.

Characterization of the promoter region of the human c-kit proto-oncogene.

The c-kit proto-oncogene encodes a tyrosine kinase receptor for stem cell factor and plays a critical role in the growth and differentiation of various types of cells including hematopoietic stem cells. To investigate the mechanisms of its transcriptional regulation, we isolated the 5 flanking region of the human c-kit gene and characterized its promoter activity in hematopoietic cells. Nucleotide sequence analysis revealed that the 1.2 kb 5 flanking region lacked a typical "TATA box," but had a relatively high G + C content and four potential Sp1-binding sites. Putative binding sites for AP-2, basic helix-loop-helix proteins, Ets-domain proteins, Myb and GATA-1 were also found. Primer extension and S1 nuclease protection analyses of hematopoietic cells indicated that the major transcription start sites are 62 bp and 58 bp upstream of the translation start site. Essentially the same start sites were detected in non-hematopoietic cells such as small cell lung carcinoma and glioblastoma: this single promoter in c-kit is different from the multiple promoter system of c-fms, a c-kit-related gene, in which at least two promoters are differently used in hematopoietic and non-hematopoietic cells. An analysis of the c-kit 5 flanking region using the bacterial chloramphenicol acetyltransferase gene (CAT assay) in human erythroleukemia HEL cells, which express the endogenous c-kit mRNA at high levels, showed that a region from -180 to -22 is important for the expression of the c-kit gene. In addition, a negative regulatory element(s) is suggested to be involved in the regulation of the c-kit gene expression in mammals.

Expression of the c-kit proto-oncogene in myeloproliferative disorders and myelodysplastic syndromes.

The c-kit proto-oncogene is the receptor gene for the stem cell growth factor. Little is known about the distribution and role of this gene product in malignant hematopoiesis. We analysed here the expression of c-kit in myeloproliferative disorders (MPDs), including chronic myelogenous leukemia (CML), essential thrombocythemia (ET), polycythemia vera (PV), and idiopathic myelofibrosis (IMF) and in the myelodysplastic syndromes (MDS). The c-kit expression of peripheral blood mononuclear cells was measured both at the messenger RNA level using Northern analysis, the RNA dot blot technique with densitometric quantification, the sensitive reverse transcription polymerase chain reaction, and at the protein level using immunofluorescence with monoclonal antibodies. There was a statistically significant increase in c-kit messenger levels in CML, ET, PV, IMF, and MDS as compared with controls (healthy volunteers). The percentage of c-kit protein expressing cells was also higher than in the controls in these disorders. There was a significant correlation of the c-kit protein expression with the CD34 antigen of the cells. expression correlated with the phase of the disease, being highest in the blast crisis of CML and in the RAEB/RAEBt phases of MDS. The data suggest that increased amounts of circulating stem/progenitor cells with c-kit receptor are found in MPDs and MDS. It is possible that elevated c-kit expression could maintain the affected clone in MPDs and MDS.

Activating mutations of the c-kit proto-oncogene in a human mast cell leukemia cell line.

The c-kit proto-oncogene encodes a receptor tyrosine kinase that is known to play a crucial role in mast cell growth and differentiation. In a human mast cell leukemia cell line (HMC-1), KitR was found to be constitutively phosphorylated on tyrosine, activated and associated with phosphatidylinositol 3-kinase (P13K) in the absence of autocrine production of SCF. Sequencing of c-kit cDNA revealed that c-kit genes of HMC-1 cells were composed of a normal, wild-type allele and a mutant allele with two point mutations in codon 560 and codon 816, resulting in intracellular amino acid substitutions of Gly-560 for Val and Val-816 for Asp, respectively. Murine c-kit mutants encoding Gly-559 and/or Val-814, corresponding to human Gly-560 and/or Val-816, were constructed by site-directed mutagenesis and expressed in cells of a human embryonic kidney cell line (293T). In the transfected cells, KitR (Gly-559 + Val-814) and KitR (Val-814) were strikingly phosphorylated on tyrosine and activated in the absence of SCF, whereas tyrosine phosphorylation and activation of KitR (Gly-559) or wild-type KitR was modest or little, respectively. These results suggest that constitutive activation of KitR in HMC-1 results from the activating mutations of c-kit gene, and raise the possibility that the activating mutations, particularly at codon 814 of murine c-kit or at codon 816 of human c-kit, may participate in oncogenesis of mast cells.

Sequence of a bovine c-kit proto-oncogene cDNA.

The Kit protein is a cell-surface tyrosine kinase receptor encoded by the c-kit proto-oncogene. cDNA clones encoding a protein homologous to the mouse and human Kit were isolated from a bovine cerebrum cDNA library. The deduced amino-acid sequence shows 83 and 90% identity to the mouse and human Kit, respectively.

The c-kit proto-oncogene receptor is expressed on a subset of human CD3-CD4-CD8- (triple-negative) thymocytes.

The c-kit receptor is a tyrosine-kinase transmembrane receptor first identified as an oncogene in the HZ4-feline leukemia virus and later found to be important in hematopoiesis in mice. The ligand for this receptor (Steel factor) can stimulate hematopoiesis both in vitro and in vivo. To study the pattern of c-kit receptor expression in normal human hematopoietic progenitor cells, we prepared a monoclonal antibody (9B9) against human c-kit receptor by using a synthetic peptide (amino acids 476-501) from the extracellular domain of c-kit receptor to immunize Balb/c mice. Monoclonal antibody 9B9 bound to recombinant c-kit protein, the erythroleukemic line HEL, the megakaryocytic line MEG-01, and the murine mast cell line P815. Monoclonal antibody 9B9 also bound to the surface of the CD7+CD3-CD4-CD8- T cell lymphoid cell lines DU.528 and HSB2T, and also to 1 to 4% of normal bone-marrow cells. The majority (67 +/- 6%) of CD34+ bone-marrow progenitor cells coexpressed c-kit receptor. Flow-cytometry analysis of immature CD3-CD4-CD8- (triple-negative) thymocytes indicated 30 +/- 9.5% expressed the c-kit receptor, and thymidine incorporation assay revealed that the receptor is functional. Indirect fluorescent microscopy of human thymic tissue, using a monoclonal antibody against Steel factor, revealed its presence on scattered mononuclear cells within the intralobular septae and the subcapsular cortex, which are regions where the triple-negative thymocytes are also localized. These data provide evidence that the c-kit receptor is present on human hematopoietic bone marrow and intrathymic T cell progenitor cells, and that it likely plays a role in early T cell lymphopoiesis.

Tumor necrosis factor alpha (TNF alpha) downregulates c-kit proto-oncogene product expression in normal and acute myeloid leukemia CD34+ cells via p55 TNF alpha receptors.

tumor necrosis factor alpha (TNF alpha), as a modulator of hematopoiesis, interacts with many growth factor receptors, such as interleukin-3, granulocyte-macrophage colony-stimulating factor (CSF), and granulocyte-CSF receptors. Here, we studied the interactions between TNF alpha and the stem cell factor (SCF) receptor, c-kit, in normal CD34+ hematopoietic progenitors and their leukemic counterpart, ie, acute myeloid leukemic (AML) CD34+ cells coexpressing c-kit antigen. The results showed that (1) incubation of normal bone marrow mononuclear cells with 200 U/mL rhTNF alpha for 20 hours induced a diminution of 31.2% +/- 5.2% of CD34+ cells coexpressing c-kit; (2) the same decrease was observed using purified CD34+ cells and, furthermore, their proliferative response to SCF was inhibited by 31.5% +/- 7.3% after exposure to TNF alpha; (3) similar experiments performed on CD34+ c-kit+ AML cells from 11 patients gave comparable results. Further analysis at the mRNA level indicated that TNF alpha decreased c-kit mRNA transcripts. Moreover, using monoclonal antibodies against the two types of TNF alpha receptors, p75 and p55, we showed that the downregulation of c-kit proto-oncogene product by TNF alpha, on normal and leukemic CD34+ cells, was exclusively mediated by the TNF alpha p55 receptor. Therefore, we conclude that TNF alpha acts as a downregulator of the SCF receptor expression.

Expression of the c-kit proto-oncogene and its ligand stem cell factor (SCF) in normal and malignant human testicular tissue.

Recent findings suggest an important role of the proto-oncogene c-kit, a surface membrane receptor of the tyrosine kinase family, and its ligand stem cell factor (SCF) in normal spermatogenesis and possibly in the pathogenesis of certain testicular germ cell tumors. To further investigate this potential role, the expression of c-kit and SCF was studied in normal and malignant human testicular tissue specimens at the mRNA and protein level by Northern blot analysis and immunohistochemistry, respectively. The detection of the c-kit receptor in normal human germ cells and its natural ligand SCF in Sertoli cells suggests the presence of a local trophic regulatory system that may be active in human spermatogenesis. Additionally, c-kit expression was detected in the seminoma but not in the nonseminoma subtype of human testicular germ cell tumors (GCT). Stem cell factor was not expressed at the mRNA level in tissue from either subtype of GCT as determined by Northern blot analysis; however, the protein was detected immunohistochemically in the cytoplasm of rare tumor cells.

Oncogenic activation of v-kit involves deletion of a putative tyrosine-substrate interaction site.

The transforming gene of the Hardy-Zuckerman-4 strain of feline sarcoma virus, v-kit, arose by transduction of the cellular c-kit gene, which encodes the receptor tyrosine kinase (RTK) p145c-kit. To gain insight into the molecular basis of the v-kit transforming potential, we characterized the feline c-kit by cDNA cloning. Comparison of the feline v-kit and c-kit sequences revealed, in addition to deletions of the extracellular and transmembrane domains, three additional mutations in the v-kit oncogene product: deletion of tyrosine-569 and valine-570, the exchange of aspartate at position 761 to glycine, and replacement of the C-terminal 50 amino acids by five unrelated residues. Examinations of individual v-kit mutations in the context of chimeric receptors yielded inhibitory effects for some mutants on both autophosphorylation and substrate phosphorylation functions. In contrast, deletion of tyrosine-569 and valine-570 significantly enhanced transforming and mitogenic activities of p145c-kit, while the other mutations had no significant effects. Conservation in subclass III RTKs and the identification of the corresponding residue in beta PDGF-R, Y579, as a binding site for src family tyrosine kinases suggests an important role for Y568 in kit signal regulation and the definition of its oncogenic potential. Repositioning of Y571 by an inframe two codon deletion may be the crucial alteration resulting in enhancement of v-kit oncogenic activity.

Characterization of the promoter of the proto-oncogene c-kit.

In previous studies, we have characterized the nature and function of the proto-oncogene c-kit, which encodes a receptor tyrosine kinase. This receptor together with its ligand, a stem cell growth factor, constitutes a cell signaling system which is crucial for the development of hematopoietic, melanocytic and germ cells. The expression of the gene correlates with its protein functions in specific cell lineages and is temporally and spatially regulated during fetal and adult life. As a start point to study the gene regulation, we have characterized the promoter of the c-kit gene. A single transcription initiation site located 58 bases upstream of the ATG start codon has been identified. The sequence upstream to the initiation site reveals a TATA-less, non-GC rich promoter. Several potential binding sites for transcription factors pertinent to c-kit expression, such as Sp-1, GATA-1, myb and Oct-4, have been identified. Promoter activities of different lengths of the 5 sequence have been analyzed in transient expression assay. The 2.7 kb of the 5 sequence facilitates the expression of the CAT gene in several cell lines while the sequence further upstream from 2.7 to 5.0 kb shows a negative regulatory activity. This study reveals a unique promoter of the c-kit gene and provides a basis for further elucidation of the regulatory mechanism of c-kit gene expression.

The cell surface receptor encoded by the proto-oncogene KIT and its ligand.

The mouse liver is a frequent target organ for chemical carcinogenesis (Huff et al., 1988, 1991; Gold et al., 1989) and tumor development exhibits preferential strain sensitivity (Dragani et al., 1992; Drinkwater and Bennett, 1991). In some reports a positive correlation has been observed between the degree of spontaneous liver tumor incidence and the propensity to develop liver tumors after treatment with chemical carcinogens (Della Porta et al., 1967; Flaks, 1968; Dragani et al., 1984, 1987; Diwan et al., 1986; Drinkwater and Ginsler, 1986), but this is not always the case (Grasso and Hardy, 1975; Hanigan et al., 1988; Dragani et al., 1992). Thus, the interpretation of this endpoint in assessing potential health hazards to humans continues to be the subject of active debate. Studies of molecular and genetic factors that modulate the genesis of mouse liver tumors should enhance our understanding of the relevance of this response following exposure to genotoxic as well as nongenotoxic chemicals. To utilize intelligently animal models as surrogates for human carcinogenesis, the validity of rodent tumor endpoints in assessing potential human health hazards from chemical exposure remains an important issue. One approach has been to understand the animal system itself and the mechanisms by which chemicals induce tumors in the animal model. Information regarding the molecular events associated with tumor induction should make the relevance of results from rodent carcinogenicity studies to human risk easier to assess. Results to date have identified activation of ras proto-oncogenes as one early event and an important factor associated with chemical induction of mouse liver neoplasia (Reynolds et al., 1986, 1987; Wiseman et al., 1986), although ras-independent pathways appear to account for an appreciable proportion of some chemically induced mouse liver tumors (Fox et al., 1990; Buchmann et al., 1991). Available data emphasize the complexity of H-ras activation in murine hepatocarcinogenesis. Not only the genetic background of the mouse but also the dose of the carcinogen may influence significantly the number of tumors containing activated H-ras. Both high sensitivity and low sensitivity strains of mice can develop liver tumors which contain activated H-ras oncogenes, showing that the ability to activate this gene does not in itself determine susceptibility to hepatocarcinogenesis. Ras gene mutational profiles in chemically induced liver tumors may be different and distinguishable from those in spontaneous tumors. Since multiple genetic as well as nongenetic events are associated with tumor development, defining a precise role for ras gene mutations when they occur in mouse liver tumors is often difficult.(ABSTRACT TRUNCATED AT 400 WORDS)FAU - Maronpot, R R

Cloning and expression of the chicken c-kit proto-oncogene.

The Kit protein is a cell-surface tyrosine kinase receptor encoded by the c-kit proto-oncogene. cDNA clones encoding chicken Kit were isolated from a chicken brain cDNA library, and the nucleotide (nt) sequence of a cDNA clone containing the entire protein-coding region was determined. The deduced amino acid (aa) sequence of chicken Kit shows 63% identity to mouse Kit, and suggests that chicken Kit shares common structural and functional features with mouse Kit. RNA blot analysis indicated that the expression pattern of the chicken c-kit transcript in chicken organs was similar to that of mouse c-kit in mice, suggesting that chicken Kit has biological roles analogous to those of mouse Kit.

Novel mutations of the KIT (mast/stem cell growth factor receptor) proto-oncogene in human piebaldism.

Piebaldism is an autosomal dominant genetic disorder of pigmentation characterized by congenital patches of white skin and hair that lack melanocytes. Piebaldism results from mutations of the KIT proto-oncogene, which encodes the cellular receptor transmembrane tyrosine kinase for mast/stem cell growth factor. Here we describe two novel KIT mutations associated with human piebaldism. These amino acid substitutions, located in the most highly conserved sections of the KIT kinase domain, would be expected to dominant-negatively inhibit KIT-dependent signal transduction, resulting in aberrant melanocyte proliferation or migration during embryologic development.

Transforming growth factor-beta 1 interferes with the proliferation-inducing activity of stem cell factor in myelogenous leukemia blasts through functional down-regulation of the c-kit proto-oncogene product.

Blast cells, obtained from patients with acute myelogenous leukemia (AML), that express surface binding sites for human stem cell factor (SCF) respond proliferatively upon exposure to this molecule. In the presence of human transforming growth factor-beta 1 (TGF-beta 1) the capacity of SCF to augment the proliferative state of AML blasts was, however, almost completely abolished. This inhibitory action of TGF-beta 1 could be reversed by a neutralizing anti-TGF-beta 1 antibody. Studies on the mechanism of TGF-beta 1 inhibition of SCF-induced proliferation of AML blasts revealed that TGF-beta 1 treatment of these cells was associated with down-regulation of SCF receptor surface expression, as detected with a specific monoclonal antibody, which appeared to be preferentially due to an acceleration of decay of mRNA for the c-kit proto-oncogene encoding the SCF receptor, without an effect on the overall transcriptional activity of the c-kit gene. Direct evidence to prove the importance of c-kit down-regulation in the inhibitory effect of TGF-beta 1 on AML growth came also from experiments demonstrating that signal transduction of SCF could be significantly diminished in the presence of TGF-beta 1, as demonstrated by measuring c-kit kinase-associated phosphorylation of target proteins.

Phorbol ester 12-O-tetradecanoylphorbol-13-acetate down-regulates expression of the c-kit proto-oncogene product.

Modulation of expression of the c-kit proto-oncogene product, the receptor for the recently identified stem cell factor, was studied on 12-O-tetradecanoylphorbol-13-acetate (TPA)-stimulated cultures of CD34+ normal bone marrow progenitor cells, blast cells from patients with primary acute myelogenous leukemia, cells from the leukemia cell lines HEL and MO7E, as well as cultured HMC-1 mast cells. expression of c-kit was assessed on both RNA and protein level employing standard Northern blotting, reverse transcription, and polymerase chain reaction-based Southern blotting, as well as cell surface labeling with anti-c-kit mAb YB5.B8. Treatment of virtually ALL cell types with nontoxic concentrations of TPA (10(-9) M) for at least 48 h was associated with down-regulation of synthesis of c-kit transcripts and stem cell factor-receptor surface expression. Studies on the mechanism of action of TPA utilizing the HEL erythroleukemia line showed that TPA was primarily acting by accelerating the turnover of c-kit RNA most likely through induction of a destabilizing protein. The effect of TPA on c-kit expression levels was independent of TPA-mediated induction of differentiation since other compounds including IFN-gamma, vitamin D3, retinoic acid, arabinofuranosylcytosine, butyric acid, and camptothecin, which also effectively induced differentiation of HEL cells, failed to alter levels of c-kit expression.

Expression, function and activation of the proto-oncogene c-kit product in human leukemia cells.

The c-kit proto-oncogene encodes a receptor tyrosine kinase that is considered to play important roles in hematopoiesis. The proto-oncogene c-kit product is expressed on various types of human cell lines derived from leukemic cells of erythroid, megakaryocytic and mast-cell lineages. Also, the c-kit product is detectable in blast cells in most cases of acute myeloblastic leukemia (AML) and in some cases of chronic myelogenous leukemia (CML) in blastic crisis (BC). By contrast, little or no expression of c-kit is observed in human leukemia cell lines of lymphoid lineage and in blast cells in acute lymphoblastic leukemia (ALL). Tyrosine phosphorylation and activation of the c-kit product with the ligand for c-kit (stem cell factor: SCF) results in proliferation of some human leukemia cell lines, such as M07E, and blast cells in a substantial fraction of AML cases. In addition, SCF appears to have an activity in inducing differentiation of certain types of leukemic cells. In some cases, further, the c-kit product is found to be activated in leukemic cells even before the stimulation with SCF. These results suggest that c-kit may be involved in excessive proliferation and aberrant differentiation of human leukemia cells.

Identification of mutations in the coding sequence of the proto-oncogene c-kit in a human mast cell leukemia cell line causing ligand-independent activation of c-kit product.

The c-kit proto-oncogene encodes a receptor tyrosine kinase. Binding of c-kit ligand, stem cell factor (SCF) to c-kit receptor (c-kitR) is known to activate c-kitR tyrosine kinase, thereby leading to autophosphorylation of c-kitR on tyrosine and to association of c-kitR with substrates such as phosphatidylinositol 3-kinase (PI3K). In a human mast cell leukemia cell line HMC-1, c-kitR was found to be constitutively phosphorylated on tyrosine, activated, and associated with PI3K without the addition of SCF. The expression of SCF mRNA transcript in HMC-1 cells was not detectable by means of PCR after reverse transcription (RT-PCR) analysis, suggesting that the constitutive activation of c-kitR was ligand independent. Sequencing of whole coding region of c-kit cDNA revealed that c-kit genes of HMC-1 cells were composed of a normal, wild-type allele and a mutant allele with two point mutations resulting in intracellular amino acid substitutions of Gly-560 for Val and Val-816 for Asp. Amino acid sequences in the regions of the two mutations are completely conserved in ALL of mouse, rat, and human c-kit. In order to determine the causal role of these mutations in the constitutive activation, murine c-kit mutants encoding Gly-559 and/or Val-814, corresponding to human Gly-560 and/or Val-816, were constructed by site-directed mutagenesis and expressed in a human embryonic kidney cell line, 293T cells. In the transfected cells, both c-kitR (Gly-559, Val-814) and c-kitR (Val-814) were abundantly phosphorylated on tyrosine and activated in immune complex kinase reaction in the absence of SCF, whereas tyrosine phosphorylation and activation of c-kitR (Gly-559) or wild-type c-kitR was modest or little, respectively. These results suggest that conversion of Asp-816 to Val in human c-kitR may be an activating mutation and responsible for the constitutive activation of c-kitR in HMC-1 cells.

Transfection of the c-myc oncogene into normal Epstein-Barr virus-harboring B cells results in new phenotypic and functional features resembling those of Burkitt lymphoma cells and normal centroblasts.

Activated c-myc gene was introduced into the cells of three normal Epstein-Barr virus (EBV)-positive lymphoblastoid B cell lines (LCL). The cells were monitored for the appearance of new phenotypic and functional features compared with the control LCL cells transfected with plasmid that did not contain the c-myc gene. The LCL-expressing c-myc constitutively did not arrest growth in low serum concentration. However, the cell number in the cultures failed to increase because of substantial cell death. Death was due to apoptosis as demonstrated by flow cytometric analysis of propidium iodide-stained cells, by typical DNA laddering in gel electrophoresis, and by the inspection of Giemsa-stained cell smears. Apoptosis was also induced by exposing the transfected cells to antibodies directed to the immunoglobulin mu chain (a-mu-ab) irrespective of the serum concentration in the culture. Exposure of the cells to CD40 ligand (CD40L) or CD40 monoclonal antibody prevented cell apoptosis. Upon transfection with c-myc, the LCL cells acquired a vacuolated morphology that was never observed in control cells. Moreover, the expression of CD10 and CD38 was upregulated, while that of CD39 and especially CD23 was downregulated. Unlike that observed in certain Burkitt lymphoma (BL) cell lines that share the same surface phenotype (CD10+CD38+CD23-CD39-), the c-myc-transfected cells expressed lymphocyte function-associated (LFA) 1, LFA-3, and intercellular adhesion molecule 1 and grew in large clumps rather than single-cell layers. expression of CD10 and CD38 was particularly evident on the cells undergoing apoptosis, thus suggesting a correlation between the presence of these markers and the apoptotic process. Cells placed in conditions favoring in vitro apoptosis displayed downregulation of Bcl-2 protein. Bcl-2 expression was, however, upregulated when the cells were exposed to CD40L. These data indicate that the B cells expressing c-myc constitutively acquire some of the features of normal centroblasts and of BL cells, including the expression of CD10 and CD38, and the propensity to undergo apoptosis, which can be prevented by exposure to CD40L. Therefore, these cells can serve as a model system to study both BL lymphomagenesis as well as the process of B cell selection occurring in the germinal centers.

Mutation of the proto-oncogene c-kit blocks development of interstitial cells and electrical rhythmicity in murine intestine.

1. Interstitial cells of Cajal (ICs) have been proposed as pacemakers in the gastrointestinal tract. We studied the characteristics and distribution of ICs and electrical activity of small intestinal muscles from mice with mutations at the dominant-white spotting/c-kit (W) locus because the tyrosine kinase function of c-kit may be important in the development of the IC network. 2. W/WV mutants (days 3-30 postpartum) had few ICs in the myenteric plexus region compared with wild type (+/+) siblings. The few ICs present were associated with neural elements and lay between myenteric ganglia and the longitudinal muscle layer. 3. Electrical recordings from intestinal muscle strips showed that electrical slow waves were always present in muscles of +/+ siblings, but were absent in W/WV mice. 4. Muscles from W/WV mice responded to stimulation of intrinsic nerves. Neural responses, attributed to the release of acetylcholine, nitric oxide and other unidentified transmitters, were recorded. 5. These findings are consistent with the hypothesis that ICs are a critical element in the generation of electrical rhythmicity in intestinal muscles. The data also show that neural regulation of gastrointestinal muscles can develop independently of the IC network. 6. W locus mutants provide a powerful new model for studies of the physiological role of ICs and the significance of electrical rhythmicity to normal gastrointestinal motility.

Absence of point mutations in a functionally important part of the extracellular domain of the c-kit proto-oncogene in a series of patients with acute myeloid leukemia (AML).

The proto-oncogenes c-fms and c-kit belong to a family of growth factor receptors possessing protein kinase activity. It has been shown that transfection of a c-fms gene carrying a point mutation at codon 301, leads to a ligand-independent transformation of mouse NIH3T3 cells. In human acute myeloid leukemia (AML), point mutations at codon 301 of the c-fms gene have been observed implying an important role in the transformation process. The possibility of a point mutation of the c-kit proto-oncogene was investigated. We sequenced a segment of the c-kit proto-oncogene coding for a part of the extracellular domain. This segment was 40.7% homologous to the c-fms region encompassing codon 301. c-DNA was prepared from peripheral blood or bone marrow cells from 25 patients with AML, from four patients with myelodysplastic syndrome (MDS) and from three human myeloid cell lines. The region of interest was amplified with two rounds of polymerase chain reactions (PCR) with nested primers and directly sequenced. No point mutations were found in the investigated samples. Thus, point mutations in this segment of the c-kit gene do not seem to play an important role in the transformation process of human acute leukemia.

[Proto-oncogene C-kit expression in human cell lines of malignant melanoma].

Secretion of the antidiuretic hormone (ADH) vasopressin is increased when body fluid homeostasis is disturbed by dehydration. Associated with this increased secretion is an elevation of vasopressin mRNA in magnocellular hypothalamic neurons projecting to the posterior pituitary. The proto-oncogene c-fos codes for a nuclear phospho-protein Fos which binds to specific DNA elements and acts as a transcriptional regulator coupling short-term extracellular stimuli to long-term responses by altering secondary target gene expression. This study in rats examined the time courses of dehydration induced c-fos expression and the change of vasopressin gene expression in the magnocellular neurons of the hypothalamus. Immunocytochemical and in situ hybridization study demonstrated that c-fos was induced by acute intracellular dehydration in the hypothalamic magnocellular nuclei of paraventricular (PVN), supraoptic (SON), and accessory groups such as nucleus circularis. Double-label immunocytochemical study co-localized Fos and vasopressin-neurophysin immunoreactivity in the same magnocellular neurons in the SON and PVN. In situ hybridization analysis after acute dehydration revealed a rapid and transient c-fos induction followed by a persistent increase in vasopressin mRNA for up to 2 days even after rehydration. Furthermore, prevention of c-fos translation by pretreatment with protein synthesis inhibitor cycloheximide attenuated this dehydration induced increase in vasopressin mRNA. This study demonstrated that an increase in vasopressin transcription after acute dehydration is dependent on an early phase of protein synthesis.

Differential expression of the c-kit proto-oncogene in germ cell tumours.

The c-kit proto-oncogene product and its ligand stem cell factor play an important role in haematopoiesis, spermatogenesis, and melanogenesis. Using an anti-c-kit antiserum raised against a synthetic peptide, we studied the immunohistochemical expression of the c-kit gene product in 60 germ cell tumours (GCTs) (53 testicular, 7 extragonadal), derived from primary GCTs in 45 cases and metastatic tumours in 15 cases. Twenty-eight out of 28 seminomas showed c-kit membranous staining in the majority of cells. A similar pattern of expression was seen in intratubular germ cell neoplasia. Nine out of 29 (32 per cent) non-seminomas displayed cytoplasmic, but not membranous, c-kit immunoreactivity in occasional cells. In three mixed GCTs, c-kit expression was limited to the seminoma component. In normal testis, c-kit expression was observed in some basal tubular cells, corresponding to undifferentiated spermatogonia. These results suggest a role for c-kit in the oncogenesis of GCT, where down-regulation of c-kit might be a critical step during progression from seminomas to non-seminomas. Immunohistochemical analysis of c-kit should be considered as a diagnostic aid for GCT and in particular may be helpful in the identification of certain extragonadal seminomas.

c-Kit proto-oncogene is more likely to lose expression in differentiated thyroid carcinoma than three thyroid-specific genes: thyroid peroxidase, thyroglobulin, and thyroid stimulating hormone receptor.

Although c-kit proto-oncogene product is known to be weakly expressed on normal thyrocytes, its function is unclear. In order to investigate the significance of thyroid c-kit, c-kit gene expression in 37 various thyroid tissues was analyzed by comparing c-kit gene expression with the mRNA expression of three thyroid-specific genes: thyroid peroxidase, thyroglobulin, and thyroid stimulating hormone receptor, c-kit mRNA was hardly detected by the usual northern blot method in 2 of 7 follicular carcinomas, 11 of 12 papillary carcinomas, and a medullary carcinoma. On the other hand, a high level of c-kit mRNA expression was found in ALL 17 benign thyroid tissues (4 normal thyroid tissues, 4 Graves disease, 2 adenomatous goiters, and 7 follicular adenomas). This study found that c-kit proto-oncogene is more likely to lose expression in differentiated thyroid carcinoma than any thyroid-specific gene. Decreased c-kit gene expression may serve as an indicator for the de-differentiation of thyrocytes.

JAK2 is associated with the c-kit proto-oncogene product and is phosphorylated in response to stem cell factor.

Stem cell factor (SCF) is a hematopoietic growth factor that interacts with the receptor tyrosine kinase, c-kit. We have found that SCF-stimulates rapid and transient tyrosine phosphorylation of JAK2 in human and murine cell lines, as well as in normal human progenitor cells. JAK2 and c-kit were associated in unstimulated cells with further recruitment of JAK2 to the c-kit receptor complex after SCF stimulation. Treatment of cells with JAK2 antisense oligonucleotides resulted in a 46% decrease in SCF-induced proliferation. These data demonstrate that SCF induces tyrosine phosphorylation of JAK2 and suggest that JAK2 is a component of the SCF signal transduction pathway.

Immunohistochemical expression of the c-kit proto-oncogene product in human malignant and non-malignant breast tissues.

The immunohistochemical expression of c-kit proto-oncogene product in 57 breast cancer tissues was studied using anti-c-kit proto-oncogene product antibody in comparison with 20 normal breast tissues and 58 benign breast tumours. In normal breast tissues, the c-kit proto-oncogene product was strongly expressed on cell membrane and/or cytoplasm of alveolar and ductal cells. The immunoreactive score (IRS) of c-kit proto-oncogene product in normal mammary epithelia was 6.22 +/- 2.11 (mean +/- s.d.). In benign breast diseases, the c-kit proto-oncogene product was detected heterogeneously with a reduced IRS (3.33 +/- 2.44). In breast cancer tissues, the expression of the immunoreactive c-kit proto-oncogene product was often deleted and the average IRS was significantly reduced compared to those of normal breast tissues or benign breast diseases tissues. Among benign diseases, the average IRS of intraductal papilloma was significantly reduced (1.34 +/- 1.70) and the staining intensity and pattern were found to be similar to those seen in breast cancer. The results in this study suggested that the c-kit proto-oncogene product is correlated with the growth control or the differentiation of normal breast epithelium. Also, the loss of the expression of this protein may indicate the change of the signal transduction in relation to malignant transformation in human mammary epithelium.

A novel potentially diagnostic polymorphism (4894 A/C) in exon 10 of the human c-kit proto-oncogene.

Analysis of apoptosis, active and controllable cell death, has demonstrated that the size of a cell population can be regulated by changes in the cell death rate as well as in the rates of proliferation and differentiation. Factors which alter the rate of cell death, such as expression of the proto-oncogene bcl-2, can therefore directly affect the number of cells within a population. Bcl-2 has been shown to suppress apoptosis in response to a variety of stimuli and to act as a complementary survival signal for the random acquisition of other oncogenic mutations, such as deregulated c-myc. The Epstein Barr virus (EBV) gene BHRF1 was the first of a family of bcl-2 homologues now being identified. BHRF1 and bcl-2 share 25% primary amino acid sequence homology. Here we show that gamma radiation and several cytotoxic anticancer agents induce apoptosis in Burkitt s lymphoma (BL) cell lines, as has been found in several other systems. Using gene transfection studies we have also shown that expression of either BHRF1 or bcl-2 in BL cell lines significantly suppresses apoptosis in response to a variety of anticancer treatment. This has confirmed that BHRF1 is functionally homologous to bcl-2 in B-cells and suggests that BHRF1 may act to prevent apoptosis during EBV infection, maximising virus particle production, as has been suggested for other human and insect viral genes. Suppression of chemotherapeutic drug induced cell death by bcl-2 and BHRF1 as demonstrated in this cell system, results in resistance to a variety of different agents and may represent an alternative mechanism by which multidrug resistance arises during chemotherapy.

The dominant white spotting oncogene allele Kit(W-42J) exacerbates XY(DOM) sex reversal.

The Y chromosome from certain populations of M. m. domesticus is incapable of normal testis determination in the B6 inbred strain resulting in XY hermaphrodites or XY females (XY(DOM) sex reversal). B6 consomic strains have been developed with either transient (B6-Y(AKR)) or severe (B6-Y(TIR)) XY(DOM) sex reversal. We report that a point mutation, the dominant white spotting oncogene allele, Kit(W-42J), exacerbates XY(DOM) sex reversal. In B6-Y(AKR), penetrance of the trait is low; however, in B6-Y(TIR), Kit(W-42J) exacerbated sex reversal to such an extent that almost ALL XY progeny developed into females. The exacerbation of sex reversal was not linked to retardation of early fetal growth or reduction of testis size. Furthermore, semiquantitative RT-PCR for the testis-determining gene, Sry, suggests that exacerbation of sex reversal in B6-Y(TIR) is not due to blockade of Sry expression, a substantial delay in initiation of Sry expression, or exceptionally low levels of Sry mRNAs. We propose that Kit(W-42J) enhances sex reversal by adversely affecting a critical step in testis differentiation that is downstream of Sry.

Oncogenic mutation in the Kit receptor tyrosine kinase alters substrate specificity and induces degradation of the protein tyrosine phosphatase SHP-1.

Activating mutations in the Kit receptor tyrosine kinase have been identified in both rodent and human mast cell leukemia. One activating Kit mutation substitutes a valine for aspartic acid at codon 816 (D816V) and is frequently observed in human mastocytosis. mutation at the equivalent position in the murine c-kit gene, involving a substitution of tyrosine for aspartic acid (D814Y), has been described in the mouse mastocytoma cell line P815. We have investigated the mechanism of oncogenic activation by this mutation. expression of this mutant Kit receptor tyrosine kinase in a mast cell line led to the selective tyrosine phosphorylation of a 130-kDa protein and the degradation, through the ubiquitin-dependent proteolytic pathway, of a 65-kDa phosphoprotein. The 65-kDa protein was identified as the src homology domain 2 (SH2)-containing protein tyrosine phosphatase SHP-1, a negative regulator of signaling by Kit and other hematopoietic receptors, and the protein product of the murine motheaten locus. This mutation also altered the sites of receptor autophosphorylation and peptide substrate selectivity. Thus, this mutation activates the oncogenic potential of Kit by a novel mechanism involving an alteration in Kit substrate recognition and the degradation of SHP-1, an attenuator of the Kit signaling pathway.

Expression and function of the c-kit proto-oncogene protein in mouse sperm.

The presence and role of the c-kit protein were examined in mature sperm of the mouse. Monoclonal antibodies (mAbs) against the c-kit protein were used to perform immunohistochemical staining, electron microscopy studies, and Western blot analysis. The acrosomal region of both fixed and unfixed noncapacitated sperm stained with the antibodies. No acrosomal staining was noted in acrosome-reacted (AR) sperm. Electron microscopy studies demonstrated immunogold label on the plasma membrane of the acrosome and confirmed the lack of binding following the acrosome reaction. Proteins corresponding to 33 kDa, 48 kDa, and 150 kDa were detected by the antibodies utilizing Western blot analysis. The 48-kDa and 150-kDa proteins were released into the media during sperm capacitation, and release from the acrosome was dependent upon the acrosome reaction. The mAbs significantly inhibited the acrosome reaction and increased sperm agglutination. Monoclonal antibody ACK1 significantly inhibited the motility of the sperm, whereas mAbs ACK2 and NCL-ckit did not. These results suggest that c-kit-related proteins are present in mature sperm and may play a role in capacitation and/or the acrosome reaction.

Proto-oncogene c-kit expression in malignant melanoma: protein loss with tumor progression.

The c-kit gene encodes a transmembrane receptor that has tyrosine kinase activity. c-kit plays a role in hematopoiesis, gametogenesis, and melanogenesis. c-kit is found in melanocytes, and there is evidence that expression is lost in melanoma. We studied 85 melanocytic lesions for c-kit by immunohistochemical techniques using a monoclonal antibody. The lesions included banal nevi, junctional and compound nevi with melanocytic dysplasia, nontumorigenic radial growth phase melanoma, tumorigenic vertical growth phase melanoma, and metastatic melanoma. We found intense membrane staining in normal melanocytes and mast cells. Staining in compound nevi was strongest in junctional and superficial dermal components, whereas dermal nevi showed weak reactivity. Dysplastic nevi stained strongly, particularly in junctional cells. In melanoma, strong reactivity was most prominent in radial growth phase disease, but there was little or no staining in vertical growth phase and metastatic melanomas. In summary, c-kit protein is expressed in normal melanocytes, benign nevi, dysplastic nevi and nontumorigenic melanoma, but expression is lost in tumorigenic primary melanomas and metastases. The role of c-kit loss in advanced melanoma requires additional investigation.

Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors.

Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumors in the human digestive tract, but their molecular etiology and cellular origin are unknown. Sequencing of c-kit complementary DNA, which encodes a proto-oncogenic receptor tyrosine kinase (KIT), from five GISTs revealed mutations in the region between the transmembrane and tyrosine kinase domains. ALL of the corresponding mutant KIT proteins were constitutively activated without the KIT ligand, stem cell factor (SCF). Stable transfection of the mutant c-kit complementary DNAs induced malignant transformation of Ba/F3 murine lymphoid cells, suggesting that the mutations contribute to tumor development. GISTs may originate from the interstitial cells of Cajal (ICCs) because the development of ICCs is dependent on the SCF-KIT interaction and because, like GISTs, these cells express both KIT and CD34.

Elevated expression of the proto-oncogene c-kit in patients with mastocytosis.

The stem cell factor (SCF)c-kit receptor interaction plays a critical role in the development and survival of mast cells. Several studies have also associated c-kit receptor mutations with the human diseases, mastocytosis and piebaldism. Overexpression of c-kit has been reported to be associated with myeloproliferative disorders and myelodysplastic syndromes. Using peripheral blood mononuclear cells (PBMCs) from 11 patients with indolent mastocytosis (category I), mastocytosis with an associated hematologic disorder (category II), or aggressive mastocytosis (category III); a patient with CMML unassociated with mastocytosis, and PBMCs from 13 normal subjects, we examined the level of expression of c-kit mRNA along with other c-kit isoforms to determine if overexpression of the c-kit receptor was associated with mastocytosis. Using quantitative competitive PCR, c-kit mRNA levels on average were found to be statistically elevated in the five patients with mastocytosis with an associated hematologic disorder and in the patient with aggressive mastocytosis as compared with controls, but not elevated in patients with indolent mastocytosis. The relative mRNA expression for the two c-kit isoforms was not significantly different in the mastocytosis patients compared with controls. This demonstration of the overexpression of c-kit mRNA in mastocytosis, and particularly those patients with clinical evidence of myelodysplastic syndrome, adds evidence to support the conclusion that mastocytosis, at least in some patients, is a feature of myelodysplasia; and suggests that determination of c-kit mRNA expression in PBMCs may provide an additional approach to assessing prognosis.

Assignment of the horse mitochondrial glutamate oxaloacetate transaminase 2 (GOT2) and v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog (KIT) to horse chromosome 3 by in situ hybridization.

Predicting the clinical behavior of prostate carcinoma can be difficult; one approach is to identify molecular prognostic markers. We evaluated proliferative rate (MIB-1 antibody) and expression of bcl-2, p53, and retinoblastoma (pRB) proteins, which have cell cycle-related functions, in 208 consecutive radical prostatectomy specimens. Values were correlated with histopathologic parameters (Gleason tumor score, tumor amount, capsule invasion, and involvement of surgical margins, seminal vesicles, or lymph nodes) and with recurrence-free survival (4-year median follow-up). A high MIB-1 proliferative rate was associated with ALL of the measured histopathologic parameters, p53 overexpression with tumor amount, and pRB expression with positive lymph nodes. pRB and p53 expression levels were not associated with differences in recurrence-free survival. A high MIB-1 proliferative rate and bcl-2 positivity were associated with increased recurrence, both considered individually, and also independently and additively when examined together and with the most predictive histopathologic factors (Gleason tumor score and seminal vesicle involvement). MIB-1 proliferative rate and bcl-2 positivity may prove to be useful markers for poor prognosis in prostate carcinoma.

Expression of the c-kit proto-oncogene in rat hepatic allografts during acute rejection.

The role of the c-kit proto-oncogene in organ allograft rejection is not known. We investigated the level of c-kit expression following allogeneic transplantation of ACI rat liver grafts into LEW recipients. We studied c-kit mRNA and protein expression in groups of transplant recipients receiving hepatic isografts, hepatic allografts, or hepatic allografts after donor-specific blood transfusion (DST). Pretransplantation DST significantly prolonged survival of hepatic allografts. Infiltrates expressing c-kit were observed in allografts to untreated rats but not in groups receiving isografts or allografts following DST. Northern analysis also demonstrated abundant c-kit mRNA transcripts in the untreated allograft group in contrast to the isograft and the DST-treated groups. In addition, significantly more transcripts for interleukin-12 (IL-12), which is synergistic with c-kit, were present in untreated than in DST-treated allograft groups. In contrast, transforming growth factor beta (TGF-beta), which inhibits c-kit synthesis, was expressed abundantly in hepatic allografts to DST-treated rats but not in allografts to untreated animals. Transcripts for IL-10, which inhibits IL-12 production, were significantly more plentiful in hepatic allografts following DST than in those without DST. The results suggest that c-kit proto-oncogene expression in infiltrating cells is associated with rat hepatic allograft rejection.

Frequent expression of the c-kit proto-oncogene in canine malignant mammary tumor.

The mammary tumor is one of the popular neoplastic diseases in female dogs. In the present study, the expression of canine c-kit proto-oncogene in mammary tumor specimens was investigated to evaluate its potential usefulness as a tumor marker. By comparing the homology among the nucleotide sequences reported for human mouse, rat and feline c-kit c-DNA, a pair of primers was synthesized for the reverse transcriptase-polymerase chain reaction (RT-PCR) method. The RT-PCR product of canine spleen total RNA was shown to have 756 bp in size and to be highly homologous to the corresponding sequences reported for the mammalian species. The expression of c-kit transcript was detected in 11 mammary tumors of different histopathology including adenocarcinomas, benign and malignant mixed tumors. The level of the transcription in adenocarcinomas was significantly higher than those in malignant mixed tumors. Fifteen canine tumor specimens originated from various tissues were also tested for their c-kit transcript. In ALL of the mastocytoma samples examined, high expression of the mRNA was detected. Of other 12 tumors, only low level of RT-PCR products were detected in 5 samples, whereas no apparent amplification was observed in 7 tumors. These results indicate that the high expression of c-kit transcript is helpful for the diagnosis of canine mammary tumors.

Molecular pathology of c-kit proto-oncogene and development of gastrointestinal stromal tumors.

Tissues from 40 cases each of premenopausal and postmenopausal breast cancer were studied immunohistochemically for epidermal growth factor receptor (EGF-R) and c-erbB-2 oncoprotein. In the premenopausal group, immunopositivity for c-erbB-2 was 15% and for EGF-R 22.5%, whereas in the postmenopausal group, 45% of cases were positive for c-erbB-2 and 42.5% for EGF-R. The difference in immunoexpression of c-erbB-2 between the two groups was significant. A significant correlation was observed between the concomitant expression of c-erbB-2 as well as EGF-R and lymph node involvement. Furthermore, an association was found between c-erbB-2 positivity and histological grading of the tumour. It is interesting that the pattern of the investigated parameters indicates the difference in the pathological events of pre- and postmenopausal breast cancer.